Login to display prices
Login to display prices
PDE4DIP-phosphodiesterase 4D interacting protein Gene View larger

PDE4DIP-phosphodiesterase 4D interacting protein Gene

PTXBC025406

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDE4DIP-phosphodiesterase 4D interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDE4DIP-phosphodiesterase 4D interacting protein Gene

Proteogenix catalog: PTXBC025406
Ncbi symbol: PDE4DIP
Product name: PDE4DIP-phosphodiesterase 4D interacting protein Gene
Size: 2ug
Accessions: BC025406
Gene id: 9659
Gene description: phosphodiesterase 4D interacting protein
Synonyms: CMYA2; MMGL; myomegalin; cardiomyopathy-associated protein 2; myomegalin/phosphodiesterase 4D interacting protein variant 8; phosphodiesterase 4D interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagggcacagacagcgggtcctgctgccgccgccgatgcgactttggctgctgctgtcgcgcgtcccgccgggctcactacacgccttaccggtccggggacgcgacgcgaacccctcagtccccacggcagaccccgagccgggaaagacggcgcccggagccagccgggagctgggcagcagcggccgaggaggaagaagcagctgcggcggccacaccctggatgagagattattttgcagaggatgatggggagatggtacccagaacgagtcacacagcagcttttcttagtgacactaaagatcgaggccctccagtgcagtcacagatctggagaagtggtgaaaaggtcccgtttgtgcagacatattccttgagagcatttgagaaaccccctcaggtacagacccaggctcttcgagactttgagaagcacctcaatgacctgaagaaggagaacttcagcctcaagctgcgcatctacttcctggaggagcgcatgcaacagaagtatgaggccagccgggaggacatctacaagcggaacactgagctgaaggttgaagtggagagcttgaaacgagaactccaggacaagaaacagcatctggataaaacatgggctgatgtggagaatctcaacagtcagaatgaagctgagctccgacgccagtttgaggagcgacagcaggagacggagcatgtttatgagctcttggagaataagatgcagcttctgcaggaggaatccaggctagcaaagaatgaagctgcgcggatggcagctctggtggaagcagagaaggagtgtaacctggagctctcagagaaactgaagggagtcaccaaaaactgggaagatgtaccaggagaccaggtcaagcccgaccaatacactgaggccctggcccagagggacaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: