PDE4DIP-phosphodiesterase 4D interacting protein Gene View larger

PDE4DIP-phosphodiesterase 4D interacting protein Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDE4DIP-phosphodiesterase 4D interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDE4DIP-phosphodiesterase 4D interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025406
Product type: DNA & cDNA
Ncbi symbol: PDE4DIP
Origin species: Human
Product name: PDE4DIP-phosphodiesterase 4D interacting protein Gene
Size: 2ug
Accessions: BC025406
Gene id: 9659
Gene description: phosphodiesterase 4D interacting protein
Synonyms: CMYA2; MMGL; myomegalin; cardiomyopathy-associated protein 2; myomegalin/phosphodiesterase 4D interacting protein variant 8; phosphodiesterase 4D interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagggcacagacagcgggtcctgctgccgccgccgatgcgactttggctgctgctgtcgcgcgtcccgccgggctcactacacgccttaccggtccggggacgcgacgcgaacccctcagtccccacggcagaccccgagccgggaaagacggcgcccggagccagccgggagctgggcagcagcggccgaggaggaagaagcagctgcggcggccacaccctggatgagagattattttgcagaggatgatggggagatggtacccagaacgagtcacacagcagcttttcttagtgacactaaagatcgaggccctccagtgcagtcacagatctggagaagtggtgaaaaggtcccgtttgtgcagacatattccttgagagcatttgagaaaccccctcaggtacagacccaggctcttcgagactttgagaagcacctcaatgacctgaagaaggagaacttcagcctcaagctgcgcatctacttcctggaggagcgcatgcaacagaagtatgaggccagccgggaggacatctacaagcggaacactgagctgaaggttgaagtggagagcttgaaacgagaactccaggacaagaaacagcatctggataaaacatgggctgatgtggagaatctcaacagtcagaatgaagctgagctccgacgccagtttgaggagcgacagcaggagacggagcatgtttatgagctcttggagaataagatgcagcttctgcaggaggaatccaggctagcaaagaatgaagctgcgcggatggcagctctggtggaagcagagaaggagtgtaacctggagctctcagagaaactgaagggagtcaccaaaaactgggaagatgtaccaggagaccaggtcaagcccgaccaatacactgaggccctggcccagagggacaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat, family A (RFXANK-like), 2
- mitogen-activated protein kinase kinase 6
- SLIT-ROBO Rho GTPase activating protein 3
- lectin, galactoside-binding, soluble, 12

Buy PDE4DIP-phosphodiesterase 4D interacting protein Gene now

Add to cart