Login to display prices
Login to display prices
TPT1-tumor protein, translationally-controlled 1 Gene View larger

TPT1-tumor protein, translationally-controlled 1 Gene

PTXBC003352

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPT1-tumor protein, translationally-controlled 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TPT1-tumor protein, translationally-controlled 1 Gene

Proteogenix catalog: PTXBC003352
Ncbi symbol: TPT1
Product name: TPT1-tumor protein, translationally-controlled 1 Gene
Size: 2ug
Accessions: BC003352
Gene id: 7178
Gene description: tumor protein, translationally-controlled 1
Synonyms: HRF; TCTP; p02; p23; translationally-controlled tumor protein; fortilin; histamine-releasing factor; tumor protein, translationally-controlled 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattatctaccgggacctcatcagccacgatgagatgttctccgacatctacaagatccgggagatcgcggacgggttgtgcctggaggtggaggggaagatggtcagtaggacagaaggtaacattgatgactcgctcattggtggaaatgcctccgctgaaggccccgagggcgaaggtaccgaaagcacagtaatcactggtgtcgatattgtcatgaaccatcacctgcaggaaacaagtttcacaaaagaagcctacaagaagtacatcaaagattacatgaaatcaatcaaagggaaacttgaagaacagagaccagaaagagtaaaaccttttatgacaggggctgcagaacaaatcaagcacatccttgctaatttcaaaaactaccagttctttattggtgaaaacatgaatccagatggcatggttgctctattggactaccgtgaggatggtgtgaccccatatatgattttctttaaggatggtttagaaatggaaaaatgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice