Cart 5 Product Products 575,10 € (empty)
-
1 x HLA-DQB1-m...113,40 € -
1 x UBE2V2-ubi...113,40 € -
1 x ZDHHC8P-zi...113,40 € -
1 x CALM1-calm...113,40 € -
1 x LUC7L-LUC7...121,50 €
No products
To be determined Shipping
575,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 575,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 575,10 €
View larger 
Data sheet of TPT1-tumor protein, translationally-controlled 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TPT1-tumor protein, translationally-controlled 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003352 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TPT1 |
| Origin species: | Human |
| Product name: | TPT1-tumor protein, translationally-controlled 1 Gene |
| Size: | 2ug |
| Accessions: | BC003352 |
| Gene id: | 7178 |
| Gene description: | tumor protein, translationally-controlled 1 |
| Synonyms: | HRF; TCTP; p02; p23; translationally-controlled tumor protein; fortilin; histamine-releasing factor; tumor protein, translationally-controlled 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattatctaccgggacctcatcagccacgatgagatgttctccgacatctacaagatccgggagatcgcggacgggttgtgcctggaggtggaggggaagatggtcagtaggacagaaggtaacattgatgactcgctcattggtggaaatgcctccgctgaaggccccgagggcgaaggtaccgaaagcacagtaatcactggtgtcgatattgtcatgaaccatcacctgcaggaaacaagtttcacaaaagaagcctacaagaagtacatcaaagattacatgaaatcaatcaaagggaaacttgaagaacagagaccagaaagagtaaaaccttttatgacaggggctgcagaacaaatcaagcacatccttgctaatttcaaaaactaccagttctttattggtgaaaacatgaatccagatggcatggttgctctattggactaccgtgaggatggtgtgaccccatatatgattttctttaaggatggtttagaaatggaaaaatgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylethanolamine binding protein 1 - hydroxysteroid (17-beta) dehydrogenase 8 - hydroxysteroid (11-beta) dehydrogenase 1 - RNA binding protein S1, serine-rich domain |