TPT1-tumor protein, translationally-controlled 1 Gene View larger

TPT1-tumor protein, translationally-controlled 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPT1-tumor protein, translationally-controlled 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TPT1-tumor protein, translationally-controlled 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003352
Product type: DNA & cDNA
Ncbi symbol: TPT1
Origin species: Human
Product name: TPT1-tumor protein, translationally-controlled 1 Gene
Size: 2ug
Accessions: BC003352
Gene id: 7178
Gene description: tumor protein, translationally-controlled 1
Synonyms: HRF; TCTP; p02; p23; translationally-controlled tumor protein; fortilin; histamine-releasing factor; tumor protein, translationally-controlled 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattatctaccgggacctcatcagccacgatgagatgttctccgacatctacaagatccgggagatcgcggacgggttgtgcctggaggtggaggggaagatggtcagtaggacagaaggtaacattgatgactcgctcattggtggaaatgcctccgctgaaggccccgagggcgaaggtaccgaaagcacagtaatcactggtgtcgatattgtcatgaaccatcacctgcaggaaacaagtttcacaaaagaagcctacaagaagtacatcaaagattacatgaaatcaatcaaagggaaacttgaagaacagagaccagaaagagtaaaaccttttatgacaggggctgcagaacaaatcaagcacatccttgctaatttcaaaaactaccagttctttattggtgaaaacatgaatccagatggcatggttgctctattggactaccgtgaggatggtgtgaccccatatatgattttctttaaggatggtttagaaatggaaaaatgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylethanolamine binding protein 1
- hydroxysteroid (17-beta) dehydrogenase 8
- hydroxysteroid (11-beta) dehydrogenase 1
- RNA binding protein S1, serine-rich domain

Buy TPT1-tumor protein, translationally-controlled 1 Gene now

Add to cart