HSD17B8-hydroxysteroid (17-beta) dehydrogenase 8 Gene View larger

HSD17B8-hydroxysteroid (17-beta) dehydrogenase 8 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSD17B8-hydroxysteroid (17-beta) dehydrogenase 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSD17B8-hydroxysteroid (17-beta) dehydrogenase 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008185
Product type: DNA & cDNA
Ncbi symbol: HSD17B8
Origin species: Human
Product name: HSD17B8-hydroxysteroid (17-beta) dehydrogenase 8 Gene
Size: 2ug
Accessions: BC008185
Gene id: 7923
Gene description: hydroxysteroid (17-beta) dehydrogenase 8
Synonyms: D6S2245E; FABG; FABGL; H2-KE6; HKE6; KE6; RING2; SDR30C1; dJ1033B10.9; estradiol 17-beta-dehydrogenase 8; 17-beta-HSD 8; 17-beta-hydroxysteroid dehydrogenase 8; 3-ketoacyl-[acyl-carrier-protein] reductase alpha subunit; 3-oxoacyl-[acyl-carrier-protein] reductase; KAR alpha subunit; estrogen 17-oxidoreductase; ke-6; protein Ke6; really interesting new gene 2 protein; short chain dehydrogenase/reductase family 30C member 1; testosterone 17-beta-dehydrogenase 8; hydroxysteroid 17-beta dehydrogenase 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtctcagctccagaaccgactccgctccgcactggccttggtcacaggtgcggggagcggcatcggccgagcggtcagtgtacgcctggccggagagggggccaccgtagctgcctgcgacctggaccgggcagcggcacaggagacggtgcggctgctgggcgggccagggagcaaggaggggccgccccgagggaaccatgctgccttccaggctgacgtgtctgaggccagggccgccaggtgcctgctggaacaagtgcaggcctgcttttctcgcccaccatctgtcgttgtgtcctgtgcgggcatcacccaggatgagtttctgctgcacatgtctgaggatgactgggacaaagtcatagctgtcaacctcaagggcaccttcctagtcactcaggctgcagcacaagccctggtgtccaatggttgtcgtggttccatcatcaacatcagtagcatcgtaggaaaggtggggaacgtggggcagacaaactatgcagcatccaaggctggagtgattgggctgacccagaccgcagcccgggagcttggacgacatgggatccgctgtaactctgtcctcccagggttcattgcaacacccatgacacagaaagtgccacagaaagtggtggacaagattactgaaatgatcccgatgggacacttgggggaccctgaggatgtggcagatgtggtcgcattcttggcatctgaagatagtggatacatcacagggacctcagtggaagtcactggaggtcttttcatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxysteroid (11-beta) dehydrogenase 1
- RNA binding protein S1, serine-rich domain
- phosphodiesterase 4D interacting protein
- ankyrin repeat, family A (RFXANK-like), 2

Buy HSD17B8-hydroxysteroid (17-beta) dehydrogenase 8 Gene now

Add to cart