Login to display prices
Login to display prices
PEBP1-phosphatidylethanolamine binding protein 1 Gene View larger

PEBP1-phosphatidylethanolamine binding protein 1 Gene

PTXBC031102

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEBP1-phosphatidylethanolamine binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PEBP1-phosphatidylethanolamine binding protein 1 Gene

Proteogenix catalog: PTXBC031102
Ncbi symbol: PEBP1
Product name: PEBP1-phosphatidylethanolamine binding protein 1 Gene
Size: 2ug
Accessions: BC031102
Gene id: 5037
Gene description: phosphatidylethanolamine binding protein 1
Synonyms: HCNP; HCNPpp; HEL-210; HEL-S-34; HEL-S-96; PBP; PEBP; PEBP-1; RKIP; phosphatidylethanolamine-binding protein 1; Raf kinase inhibitory protein; epididymis luminal protein 210; epididymis secretory protein Li 34; epididymis secretory protein Li 96; hippocampal cholinergic neurostimulating peptide; neuropolypeptide h3; prostatic binding protein; raf kinase inhibitor protein; phosphatidylethanolamine binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggtggacctcagcaagtggtccgggcccttgagcctgcaagaagtggacgagcagccgcagcacccactgcatgtcacctacgccggggcggcggtggacgagctgggcaaagtgctgacgcccacccaggttaagaatagacccaccagcatttcgtgggatggtcttgattcagggaagctctacaccttggtcctgacagacccggatgctcccagcaggaaggatcccaaatacagagaatggcatcatttcctggtggtcaacatgaagggcaatgacatcagcagtggcacagtcctctccgattatgtgggctcggggcctcccaagggcacaggcctccaccgctatgtctggctggtttacgagcaggacaggccgctaaagtgtgacgagcccatcctcagcaaccgatctggagaccaccgtggcaaattcaaggtggcgtccttccgtaaaaagtatgagctcagggccccggtggctggcacgtgttaccaggccgagtgggatgactatgtgcccaaactgtacgagcagctgtctgggaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice