Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PEBP1-phosphatidylethanolamine binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PEBP1-phosphatidylethanolamine binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031102 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PEBP1 |
| Origin species: | Human |
| Product name: | PEBP1-phosphatidylethanolamine binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC031102 |
| Gene id: | 5037 |
| Gene description: | phosphatidylethanolamine binding protein 1 |
| Synonyms: | HCNP; HCNPpp; HEL-210; HEL-S-34; HEL-S-96; PBP; PEBP; PEBP-1; RKIP; phosphatidylethanolamine-binding protein 1; Raf kinase inhibitory protein; epididymis luminal protein 210; epididymis secretory protein Li 34; epididymis secretory protein Li 96; hippocampal cholinergic neurostimulating peptide; neuropolypeptide h3; prostatic binding protein; raf kinase inhibitor protein; phosphatidylethanolamine binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggtggacctcagcaagtggtccgggcccttgagcctgcaagaagtggacgagcagccgcagcacccactgcatgtcacctacgccggggcggcggtggacgagctgggcaaagtgctgacgcccacccaggttaagaatagacccaccagcatttcgtgggatggtcttgattcagggaagctctacaccttggtcctgacagacccggatgctcccagcaggaaggatcccaaatacagagaatggcatcatttcctggtggtcaacatgaagggcaatgacatcagcagtggcacagtcctctccgattatgtgggctcggggcctcccaagggcacaggcctccaccgctatgtctggctggtttacgagcaggacaggccgctaaagtgtgacgagcccatcctcagcaaccgatctggagaccaccgtggcaaattcaaggtggcgtccttccgtaaaaagtatgagctcagggccccggtggctggcacgtgttaccaggccgagtgggatgactatgtgcccaaactgtacgagcagctgtctgggaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hydroxysteroid (17-beta) dehydrogenase 8 - hydroxysteroid (11-beta) dehydrogenase 1 - RNA binding protein S1, serine-rich domain - phosphodiesterase 4D interacting protein |