Login to display prices
Login to display prices
SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene View larger

SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene

PTXBC008915

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene

Proteogenix catalog: PTXBC008915
Ncbi symbol: SERPINA5
Product name: SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene
Size: 2ug
Accessions: BC008915
Gene id: 5104
Gene description: serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5
Synonyms: PAI-3; PAI3; PCI; PCI-B; PLANH3; PROCI; plasma serine protease inhibitor; acrosomal serine protease inhibitor; plasminogen activator inhibitor III; plasminogen activator inhibitor-3; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5; serpin family A member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagctcttcctcctcttgtgcctggtgcttctcagccctcagggggcctcccttcaccgccaccacccccgggagatgaagaagagagtcgaggacctccatgtaggtgccacggtggcccccagcagcagaagggactttacctttgacctctacagggccttggcttccgctgcccccagccagaacatcttcttctcccctgtgagcatctccatgagcctggccatgctctccctgggggctgggtccagcacaaagatgcagatcctggagggcctgggcctcaacctccagaaaagctcagagaaggagctgcacagaggctttcagcagctccttcaggaactcaaccagcccagagatggcttccagctgagcctcggcaatgcccttttcaccgacctggtggtagacctgcaggacaccttcgtaagtgccatgaagacgctgtacctggcagacactttccccaccaactttagggactctgcaggggccatgaagcagatcaatgattatgtggcaaagcaaacgaagggcaagattgtggacttgcttaagaacctcgatagcaatgcggtcgtgatcatggtgaattacatcttctttaaagctaagtgggagacaagcttcaaccacaaaggcacccaagagcaagacttctacgtgacctcggagactgtggtgcgggtacccatgatgagccgcgaggatcagtatcactacctcctggaccggaacctctcctgcagggtggtgggggtcccctaccaaggcaatgccacggctttgttcattctccccagtgagggaaagatgcagcaggtggagaatggactgagtgagaaaacgctgaggaagtggcttaagatgttcaaaaagaggcagctcgagctttaccttcccaaattctccattgagggctcctatcagctggagaaagtcctccccagtctggggatcagtaacgtcttcacctcccatgctgatctgtccggcatcagcaaccactcaaatatccaggtgtctgagatggtgcacaaagctgtggtggaggtggacgagtcgggaaccagagcagcggcagccacggggacaatcttcactttcaggtcggcccgcctgaactctcagaggctagtgttcaacaggccctttctgatgttcattgtggataacaacatcctcttccttggcaaagtgaaccgcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: