SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene View larger

SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008915
Product type: DNA & cDNA
Ncbi symbol: SERPINA5
Origin species: Human
Product name: SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene
Size: 2ug
Accessions: BC008915
Gene id: 5104
Gene description: serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5
Synonyms: PAI-3; PAI3; PCI; PCI-B; PLANH3; PROCI; plasma serine protease inhibitor; acrosomal serine protease inhibitor; plasminogen activator inhibitor III; plasminogen activator inhibitor-3; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5; serpin family A member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagctcttcctcctcttgtgcctggtgcttctcagccctcagggggcctcccttcaccgccaccacccccgggagatgaagaagagagtcgaggacctccatgtaggtgccacggtggcccccagcagcagaagggactttacctttgacctctacagggccttggcttccgctgcccccagccagaacatcttcttctcccctgtgagcatctccatgagcctggccatgctctccctgggggctgggtccagcacaaagatgcagatcctggagggcctgggcctcaacctccagaaaagctcagagaaggagctgcacagaggctttcagcagctccttcaggaactcaaccagcccagagatggcttccagctgagcctcggcaatgcccttttcaccgacctggtggtagacctgcaggacaccttcgtaagtgccatgaagacgctgtacctggcagacactttccccaccaactttagggactctgcaggggccatgaagcagatcaatgattatgtggcaaagcaaacgaagggcaagattgtggacttgcttaagaacctcgatagcaatgcggtcgtgatcatggtgaattacatcttctttaaagctaagtgggagacaagcttcaaccacaaaggcacccaagagcaagacttctacgtgacctcggagactgtggtgcgggtacccatgatgagccgcgaggatcagtatcactacctcctggaccggaacctctcctgcagggtggtgggggtcccctaccaaggcaatgccacggctttgttcattctccccagtgagggaaagatgcagcaggtggagaatggactgagtgagaaaacgctgaggaagtggcttaagatgttcaaaaagaggcagctcgagctttaccttcccaaattctccattgagggctcctatcagctggagaaagtcctccccagtctggggatcagtaacgtcttcacctcccatgctgatctgtccggcatcagcaaccactcaaatatccaggtgtctgagatggtgcacaaagctgtggtggaggtggacgagtcgggaaccagagcagcggcagccacggggacaatcttcactttcaggtcggcccgcctgaactctcagaggctagtgttcaacaggccctttctgatgttcattgtggataacaacatcctcttccttggcaaagtgaaccgcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
- asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
- ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)

Buy SERPINA5-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 Gene now

Add to cart