Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene
PTXBC001444
New product
Data sheet of CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001444 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDIPT |
| Origin species: | Human |
| Product name: | CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene |
| Size: | 2ug |
| Accessions: | BC001444 |
| Gene id: | 10423 |
| Gene description: | CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) |
| Synonyms: | PIS; PIS1; CDP-diacylglycerol--inositol 3-phosphatidyltransferase; PI synthase; PtdIns synthase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagacgaaaatatcttcctgttcgtgcccaacctcatcggttatgcccggattgtcttcgccatcatttctttctacttcatgccctgctgccccctcacggcctcctccttctacctgctcagcggcctgctggacgctttcgatggacacgctgctcgcgctcttaatcaaggaacccggtttggggccatgctggacatgctgacggaccgctgctccaccatgtgcctgttggtcaacctggccctgctgtaccctggagccacgctgttcttccaaatcagcatgagtttggatgtggccagtcactggctgcacctccacagttctgtggtccgaggcagtgagagtcacaagatgatcgacttgtccgggaatccggtgcttcggatctactacacctcgaggcctgctctgttcaccttgtgtgctgggaatgagctcttctactgcctcctctacctgttccatttctctgagggacctttagttggctctgtgggactgttccggatgggcctctgggtcactgcccccatcgccttgctgaagtcgctcatcagcgtcatccacctgatcacggccgcccgcaacatggctgccctggacgcagcagaccgcgccaagaagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 - eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) - regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 |