CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene View larger

CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene

PTXBC001444

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001444
Product type: DNA & cDNA
Ncbi symbol: CDIPT
Origin species: Human
Product name: CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene
Size: 2ug
Accessions: BC001444
Gene id: 10423
Gene description: CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
Synonyms: PIS; PIS1; CDP-diacylglycerol--inositol 3-phosphatidyltransferase; PI synthase; PtdIns synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagacgaaaatatcttcctgttcgtgcccaacctcatcggttatgcccggattgtcttcgccatcatttctttctacttcatgccctgctgccccctcacggcctcctccttctacctgctcagcggcctgctggacgctttcgatggacacgctgctcgcgctcttaatcaaggaacccggtttggggccatgctggacatgctgacggaccgctgctccaccatgtgcctgttggtcaacctggccctgctgtaccctggagccacgctgttcttccaaatcagcatgagtttggatgtggccagtcactggctgcacctccacagttctgtggtccgaggcagtgagagtcacaagatgatcgacttgtccgggaatccggtgcttcggatctactacacctcgaggcctgctctgttcaccttgtgtgctgggaatgagctcttctactgcctcctctacctgttccatttctctgagggacctttagttggctctgtgggactgttccggatgggcctctgggtcactgcccccatcgccttgctgaagtcgctcatcagcgtcatccacctgatcacggccgcccgcaacatggctgccctggacgcagcagaccgcgccaagaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
- eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
- regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1

Buy CDIPT-CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) Gene now

Add to cart