EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene View larger

EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene

PTXBC007847

New product

Data sheet of EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC007847
Product type: DNA & cDNA
Ncbi symbol: EEF1D
Origin species: Human
Product name: EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene
Size: 2ug
Accessions: BC007847
Gene id: 1936
Gene description: eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Synonyms: EF-1D; EF1D; FP1047; elongation factor 1-delta; EF-1-delta; antigen NY-CO-4; eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein); eukaryotic translation elongation factor 1 delta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggagcgggaaggcctcctgcaccctggagaccgtgtgggaagacaagcacaagtatgaggaggccgagcggcgcttctacgaacacgaggccacacaggcggccgcctccgcccagcagctgccagccgaggggccagccatgaatgggcccggccaggacgaccctgaggacgctgatgaggcggaagcccctgacggcggcagcaggcgtgatcccaggaagagccaggacagcaggaagcccctgcagaaaaagaggaagcgctcccccaagagcgggctcggccccgcggacctggccctcctgggcctctcggccgaacgtgtgtggctggacaagtcacttttcgaccaggcagagagctcctaccgccagaagctggcagatgtggctgcccaggcagcctggcctcctgccttggccccttggggtctctgcacccatggaaaccaggtggcctgccaccacgtgacctgggggatctgggtcaacaagtcctccttcgaccaggctgagcgggccttcgtggagtggtctcaggccctgttgctggcccccgagggcagccgcaggcaggggactcccaacacaggccagcaggtggccgtccccgacctggcccaccagcccagcccaccggtcaatggccagcccccgctgggcagcctgcaggcactggttcgggaggtgtggctggagaagccccggtatgatgcagccgagaggggcttctacgaggccctgtttgacggccatcccccagggaaggtgcgcctgcaagagcgagccggcctggccgagggtgcccggcggggccgcagagaccggcggggccgcaacatcttagggaacaagcgggccgggctgcgacgggccgatggggaggccccctctgccttgccctactgttacttcctgcagaaggatgcagaggccccctggctcagcaagcctgcctacgacagcgccgagtgccgccaccacgctgccgaggccctgcgtgtggcctggtgcctcgaagctgcctccctgtctcaccgacccggtcctcggtctggcctgtccgtgtccagcctgagacccaacagaaaaatggctacaaacttcctagcacatgagaagatctggttcgacaagttcaaatatgacgacgcagaaaggagattctacgagcagatgaacgggcctgtggcaggtgcctcccgccaggagaacggcgccagcgtgatcctccgtgacattgcgagagccagagagaacatccagaaatccctggctggaagctcaggccccggggcctccagcggcaccagcggagaccacggtgagctcgtcgtccggattgccagtctggaagtggagaaccagagtctgcgtggcgtggtacaggagctgcagcaggccatctccaagctggaggcccggctgaacgtgctggagaagagctcgcctggccaccgggccacggccccacagacccagcacgtatctcccatgcgccaagtggagcccccagccaagaagccagccacaccagcagaggatgacgaggatgatgacattgacctgtttggcagtgacaatgaggaggaggacaaggaggcggcacagctgcgggaggagcggctacggcagtacgcggagaagaaggccaagaagcctgcactggtggccaagtcctccatcctgctggatgtcaagccttgggatgatgagacggacatggcccagctggaggcctgtgtgcgctctatccagctggacgggctggtctggggggcttccaagctggtgcccgtgggctacggtatccggaagctacagattcagtgtgtggtggaggacgacaaggtggggacagacttgctggaggaggagatcaccaagtttgaggagcacgtgcagagtgtcgatatcgcagctttcaacaagatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
- regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
- ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
- excision repair cross-complementing rodent repair deficiency, complementation group 2

Buy EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene now

Add to cart