NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene View larger

NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011676
Product type: DNA & cDNA
Ncbi symbol: NFKBIE
Origin species: Human
Product name: NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene
Size: 2ug
Accessions: BC011676
Gene id: 4794
Gene description: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Synonyms: IKBE; NF-kappa-B inhibitor epsilon; I-kappa-B-epsilon; NF-kappa-BIE; ikB-E; ikB-epsilon; ikappaBepsilon; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon; NFKB inhibitor epsilon
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggaggcgcggaaggggccggacgaggcggaggagagccagtacgactctggcattgagtctctgcgctctctgcgctccctacccgagtccacctcggctccagcctccgggccctcggacggcagcccccagccctgcacccatcctccgggacccgtcaaggaaccacaggagaaggaagacgcggatggggagcgggctgattccacctatggctcctcctcgctcacctacaccctgtccttgctggggggccccgaggctgaggacccggccccacgcctgccactcccccacgtgggggcgctgagccctcagcagctggaagcactcacttacatctccgaggacggagacacgctggtccacctggcagtgattcatgaggccccagcggtgctgctctgttgcctggctttgctgccccaggaggtcctggacattcaaaataacctttaccagacagcactccatctggctgtacatctggaccaaccgggcgcagttcgggcactggtgctgaagggggccagccgggcactacaggaccggcatggtgacacagcccttcatgtggcctgccagcgccagcacttggcctgtgcccgctgcctgctggaagggcggccagagccaggcagaggaacatctcactctctggacctccagctgcaaaactggcaaggtctggcttgtctccacattgccacccttcagaagaaccaaccactcatggaattgctgcttcggaatggagctgacattgatgtgcaggagggcaccagtggtaagacagcgctgcacctggctgtggaaacccaagagcggggcctggtacagttcctgctccaggctggtgcccaggtagatgcccgcatgctgaacgggtgcacacccctgcacctggcagctggccggggtctcatgggcatctcatccactctgtgcaaggcgggtgctgactccctgctgcggaatgtggaggatgagacgccccaggacctgactgaggaatcccttgtccttttgccctttgatgacctgaagatctcagggaaactgctgctgtgtaccgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
- eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
- regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
- regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2

Buy NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene now

Add to cart