Login to display prices
Login to display prices
NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene View larger

NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene

PTXBC011676

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene

Proteogenix catalog: PTXBC011676
Ncbi symbol: NFKBIE
Product name: NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene
Size: 2ug
Accessions: BC011676
Gene id: 4794
Gene description: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Synonyms: IKBE; NF-kappa-B inhibitor epsilon; I-kappa-B-epsilon; NF-kappa-BIE; ikB-E; ikB-epsilon; ikappaBepsilon; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon; NFKB inhibitor epsilon
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggaggcgcggaaggggccggacgaggcggaggagagccagtacgactctggcattgagtctctgcgctctctgcgctccctacccgagtccacctcggctccagcctccgggccctcggacggcagcccccagccctgcacccatcctccgggacccgtcaaggaaccacaggagaaggaagacgcggatggggagcgggctgattccacctatggctcctcctcgctcacctacaccctgtccttgctggggggccccgaggctgaggacccggccccacgcctgccactcccccacgtgggggcgctgagccctcagcagctggaagcactcacttacatctccgaggacggagacacgctggtccacctggcagtgattcatgaggccccagcggtgctgctctgttgcctggctttgctgccccaggaggtcctggacattcaaaataacctttaccagacagcactccatctggctgtacatctggaccaaccgggcgcagttcgggcactggtgctgaagggggccagccgggcactacaggaccggcatggtgacacagcccttcatgtggcctgccagcgccagcacttggcctgtgcccgctgcctgctggaagggcggccagagccaggcagaggaacatctcactctctggacctccagctgcaaaactggcaaggtctggcttgtctccacattgccacccttcagaagaaccaaccactcatggaattgctgcttcggaatggagctgacattgatgtgcaggagggcaccagtggtaagacagcgctgcacctggctgtggaaacccaagagcggggcctggtacagttcctgctccaggctggtgcccaggtagatgcccgcatgctgaacgggtgcacacccctgcacctggcagctggccggggtctcatgggcatctcatccactctgtgcaaggcgggtgctgactccctgctgcggaatgtggaggatgagacgccccaggacctgactgaggaatcccttgtccttttgccctttgatgacctgaagatctcagggaaactgctgctgtgtaccgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: