Login to display prices
Login to display prices
HIF1A-hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) Gene View larger

HIF1A-hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) Gene

PTXBC012527

New product

Data sheet of HIF1A-hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIF1A-hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC012527
Product type: DNA & cDNA
Ncbi symbol: HIF1A
Origin species: Human
Product name: HIF1A-hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) Gene
Size: 2ug
Accessions: BC012527
Gene id: 3091
Gene description: hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Synonyms: HIF-1-alpha; HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8; bHLHe78; hypoxia-inducible factor 1-alpha; ARNT interacting protein; PAS domain-containing protein 8; basic-helix-loop-helix-PAS protein MOP1; class E basic helix-loop-helix protein 78; hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor); hypoxia-inducible factor 1 alpha isoform I.3; hypoxia-inducible factor1alpha; member of PAS protein 1; member of PAS superfamily 1; hypoxia inducible factor 1 alpha subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggcgccggcggcgcgaacgacaagaaaaagataagttctgaacgtcgaaaagaaaagtctcgagatgcagccagatctcggcgaagtaaagaatctgaagttttttatgagcttgctcatcagttgccacttccacataatgtgagttcgcatcttgataaggcctctgtgatgaggcttaccatcagctatttgcgtgtgaggaaacttctggatgctggtgatttggatattgaagatgacatgaaagcacagatgaattgcttttatttgaaagccttggatggttttgttatggttctcacagatgatggtgacatgatttacatttctgataatgtgaacaaatacatgggattaactcagtttgaactaactggacacagtgtgtttgattttactcatccatgtgaccatgaggaaatgagagaaatgcttacacacagaaatggccttgtgaaaaagggtaaagaacaaaacacacagcgaagcttttttctcagaatgaagtgtaccctaactagccgaggaagaactatgaacataaagtctgcaacatggaaggtattgcactgcacaggccacattcacgtatatgataccaacagtaaccaacctcagtgtgggtataagaaaccacctatgacctgcttggtgctgatttgtgaacccattcctcacccatcaaatattgaaattcctttagatagcaagactttcctcagtcgacacagcctggatatgaaattttcttattgtgatgaaagaattaccgaattgatgggatatgagccagaagaacttttaggccgctcaatttatgaatattatcatgctttggactctgatcatctgaccaaaactcatcatgatatgtttactaaaggacaagtcaccacaggacagtacaggatgcttgccaaaagaggtggatatgtctgggttgaaactcaagcaactgtcatatataacaccaagaattctcaaccacagtgcattgtatgtgtgaattacgttgtgagtggtattattcagcacgacttgattttctcccttcaacaaacagaatgtgtccttaaaccggttgaatcttcagatatgaaaatgactcagctattcaccaaagttgaatcagaagatacaagtagcctctttgacaaacttaagaaggaacctgatgctttaactttgctggccccagccgctggagacacaatcatatctttagattttggcagcaacgacacagaaactgatgaccagcaacttgaggaagtaccattatataatgatgtaatgctcccctcacccaacgaaaaattacagaatataaatttggcaatgtctccattacccaccgctgaaacgccaaagccacttcgaagtagtgctgaccctgcactcaatcaagaagttgcattaaaattagaaccaaatccagagtcactggaactttcttttaccatgccccagattcaggatcagacacctagtccttccgatggaagcactagacaaagttcacctgagcctaatagtcccagtgaatattgtttttatgtggatagtgatatggtcaatgaattcaagttggaattggtagaaaaactttttgctgaagacacagaagcaaagaacccattttctactcaggacacagatttagacttggagatgttagctccctatatcccaatggatgatgacttccagttacgttccttcgatcagttgtcaccattagaaagcagttccgcaagccctgaaagcgcaagtcctcaaagcacagttacagtattccagcagactcaaatacaagaacctactgctaatgccaccactaccactgccaccactgatgaattaaaaacagtgacaaaagaccgtatggaagacattaaaatattgattgcatctccatctcctacccacatacataaagaaactactagtgccacatcatcaccatatagagatactcaaagtcggacagcctcaccaaacagagcaggaaaaggagtcatagaacagacagaaaaatctcatccaagaagccctaacgtgttatctgtcgctttgagtcaaagaactacagttcctgaggaagaactaaatccaaagatactagctttgcagaatgctcagagaaagcgaaaaatggaacatgatggttcactttttcaagcagtaggaattggaacattattacagcagccagacgatcatgcagctactacatcactttcttggaaacgtgtaaaaggatgcaaatctagtgaacagaatggaatggagcaaaagacaattattttaataccctctgatttagcatgtagactgctggggcaatcaatggatgaaagtggattaccacagctgaccagttatgattgtgaagttaatgctcctatacaaggcagcagaaacctactgcagggtgaagaattactcagagctttggatcaagttaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transient receptor potential cation channel, subfamily C, member 4 associated protein
- protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
- ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5