Login to display prices
Login to display prices
GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene View larger

GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene

PTXBC026326

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene

Proteogenix catalog: PTXBC026326
Ncbi symbol: GNAI1
Product name: GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene
Size: 2ug
Accessions: BC026326
Gene id: 2770
Gene description: guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Synonyms: guanine nucleotide-binding protein G(i) subunit alpha-1; Gi1 protein alpha subunit; adenylate cyclase-inhibiting G alpha protein; guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1; G protein subunit alpha i1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcacgctgagcgccgaggacaaggcggcggtggagcggagtaagatgatcgaccgcaacctccgtgaggacggcgagaaggcggcgcgcgaggtcaagctgctgctgctcggtgctggtgaatctggtaaaagtacaattgtgaagcagatgaaaattatccatgaagctggttattcagaagaggagtgtaaacaatacaaagcagtggtctacagtaacaccatccagtcaattattgctatcattagggctatggggaggttgaagatagactttggtgactcagcccgggcggatgatgcacgccaactctttgtgctagctggagctgctgaagaaggctttatgactgcagaacttgctggagttataaagagattgtggaaagatagtggtgtacaagcctgtttcaacagatcccgagagtaccagcttaatgattctgcagcatactatttgaatgacttggacagaatagctcaaccaaattacatcccgactcaacaagatgttctcagaactagagtgaaaactacaggaattgttgaaacccattttactttcaaagatcttcattttaaaatgtttgatgtgggaggtcagagatctgagcggaagaagtggattcattgcttcgaaggagtggcggcgatcatcttctgtgtagcactgagtgactacgacctggttctagctgaagatgaagaaatgaaccgaatgcatgaaagcatgaaattgtttgacagcatatgtaacaacaagtggtttacagatacatccattatactttttctaaacaagaaggatctttttgaagaaaaaatcaaaaagagccctctcactatatgctatcaagaatatgcaggatcaaacacatatgaagaggcagctgcatatattcaatgtcagtttgaagacctcaataaaagaaaggacacaaaggaaatatacacccacttcacatgtgccacagatactaagaatgtgcagtttgtttttgatgctgtaacagatgtcatcataaaaaataatctaaaagattgtggtctcttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: