GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene View larger

GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene

PTXBC026326

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026326
Product type: DNA & cDNA
Ncbi symbol: GNAI1
Origin species: Human
Product name: GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene
Size: 2ug
Accessions: BC026326
Gene id: 2770
Gene description: guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Synonyms: guanine nucleotide-binding protein G(i) subunit alpha-1; Gi1 protein alpha subunit; adenylate cyclase-inhibiting G alpha protein; guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1; G protein subunit alpha i1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcacgctgagcgccgaggacaaggcggcggtggagcggagtaagatgatcgaccgcaacctccgtgaggacggcgagaaggcggcgcgcgaggtcaagctgctgctgctcggtgctggtgaatctggtaaaagtacaattgtgaagcagatgaaaattatccatgaagctggttattcagaagaggagtgtaaacaatacaaagcagtggtctacagtaacaccatccagtcaattattgctatcattagggctatggggaggttgaagatagactttggtgactcagcccgggcggatgatgcacgccaactctttgtgctagctggagctgctgaagaaggctttatgactgcagaacttgctggagttataaagagattgtggaaagatagtggtgtacaagcctgtttcaacagatcccgagagtaccagcttaatgattctgcagcatactatttgaatgacttggacagaatagctcaaccaaattacatcccgactcaacaagatgttctcagaactagagtgaaaactacaggaattgttgaaacccattttactttcaaagatcttcattttaaaatgtttgatgtgggaggtcagagatctgagcggaagaagtggattcattgcttcgaaggagtggcggcgatcatcttctgtgtagcactgagtgactacgacctggttctagctgaagatgaagaaatgaaccgaatgcatgaaagcatgaaattgtttgacagcatatgtaacaacaagtggtttacagatacatccattatactttttctaaacaagaaggatctttttgaagaaaaaatcaaaaagagccctctcactatatgctatcaagaatatgcaggatcaaacacatatgaagaggcagctgcatatattcaatgtcagtttgaagacctcaataaaagaaaggacacaaaggaaatatacacccacttcacatgtgccacagatactaagaatgtgcagtttgtttttgatgctgtaacagatgtcatcataaaaaataatctaaaagattgtggtctcttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
- asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
- adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
- adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1

Buy GNAI1-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 Gene now

Add to cart