ALG9-asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) Gene View larger

ALG9-asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) Gene

PTXBC009255

New product

Data sheet of ALG9-asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALG9-asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC009255
Product type: DNA & cDNA
Ncbi symbol: ALG9
Origin species: Human
Product name: ALG9-asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC009255
Gene id: 79796
Gene description: asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
Synonyms: ALG9, alpha-1,2-mannosyltransferase; alpha-1,2-mannosyltransferase ALG9; CDG1L; DIBD1; GIKANIS; LOH11CR1J; asparagine-linked glycosylation 9 alpha-12-mannosyltransferase-like protein; asparagine-linked glycosylation 9 homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase); asparagine-linked glycosylation 9 homolog (yeast, alpha- 1,2-mannosyltransferase); asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog; asparagine-linked glycosylation protein 9 homolog; disrupted in bipolar affective disorder 1; disrupted in bipolar disorder protein 1; dol-P-Man dependent alpha-1,2-mannosyltransferase; dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase; dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase; dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase; dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase; loss of heterozygosity, 11, chromosomal region 1 gene J product
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctagtcgaggggctcggcagcgcctgaagggcagcggggccagcagtggggatacggccccggctgcggacaagctgcgggagctgctgggcagccgagaggcgggcggcgcggagcaccggaccgagttatctgggaacaaagcaggacaagtctgggcacctgaaggatctactgctttcaagtgtctgctttcagcaaggttatgtgctgctctcctgagcaacatctctgactgtgatgaaacattcaactactgggagccaacacactacctcatctatggggaagggtttcagacttgggaatattccccagcatatgccattcgctcctatgcttacctgttgcttcatgcctggccagctgcatttcatgcaagaattctacaaactaataagattcttgtgttttactttttgcgatgtcttctggcttttgtgagctgtatttgtgaactttacttttacaaggctgtgtgcaagaagtttgggttgcacgtgagtcgaatgatgctagccttcttggttctcagcactggcatgttttgctcatcatcagcattccttcctagtagcttctgtatgtacactacgttgatagccatgactggatggtatatggacaagacttccattgctgtgctgggagtagcagctggggctatcttaggctggccattcagtgcagctcttggtttacccattgcctttgatttgctggtcatgaaacacaggtggaagagtttctttcattggtcgctgatggccctcatactatttctggtgcctgtggtggtcattgacagctactattatgggaagttggtgattgcaccactcaacattgttttgtataatgtctttactcctcatggacctgatctttatggtacagaaccctggtatttctatttaattaatggatttctgaatttcaatgtagcctttgctttggctctcctagtcctaccactgacttctcttatggaatacctgctgcagagatttcatgttcagaatttaggccacccgtattggcttaccttggctccaatgtatatttggtttataattttcttcatccagcctcacaaagaggagagatttcttttccctgtgtatccacttatatgtctctgtggcgctgtggctctctctgcacttcagcacagttttctgtacttccagaaatgttaccactttgtgtttcaacgatatcgcctggagcactatactgtgacatcgaattggctggcattaggaactgtcttcctgtttgggctcttgtcattttctcgctctgtggcactgttcagaggatatcacgggccccttgatttgtatccagaattttaccgaattgctacagacccaaccatccacactgtcccagaaggcagacctgtgaatgtctgtgtgggaaaagagtggtatcgatttcccagcagcttccttcttcctgacaattggcagcttcagttcattccatcagagttcagaggtcagttaccaaaaccttttgcagaaggacctctggccacccggattgttcctactgacatgaatgaccagaatctagaagagccatccagatatattgatatcagtaaatgccattatttagtggatttggacaccatgagagaaacaccccgggagccaaaatattcatccaataaagaagaatggatcagcttggcctatagaccattccttgatgcttctagatcttcaaagctgctgcgggcattctatgtccccttcctgtcagatcagtatacagtgtacgtaaactacaccatcctcaaaccccggaaagcaaagcaaatcaggaagaaaagtggaggttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
- adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
- sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
- hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)

Buy ALG9-asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) Gene now

Add to cart