Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene
PTXBC015126
New product
Data sheet of ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015126 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALG2 |
| Origin species: | Human |
| Product name: | ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC015126 |
| Gene id: | 85365 |
| Gene description: | asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) |
| Synonyms: | ALG2, alpha-1,3/1,6-mannosyltransferase; homolog of yeast ALG2; alpha-1,3-mannosyltransferase ALG2; alpha-1,3/1,6-mannosyltransferase ALG2; CDGIi; CMS14; CMSTA3; NET38; hALPG2; GDP-Man:Man(1)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase; GDP-Man:Man(1)GlcNAc(2)-PP-dolichol mannosyltransferase; GDP-Man:Man(2)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase; asparagine-linked glycosylation 2 homolog (S. cerevisiae, alpha-1,3-mannosyltransferase); asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase); asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog; asparagine-linked glycosylation protein 2 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagactgcatcttagtcaacagccagttcacagctgctgtttttaaggaaacattcaagtccctgtctcacatagaccctgatgtcctctatccatctctaaatgtcaccagctttgactcagttgttcctgaaaagctggatgacctagtccccaaggggaaaaaattcctgctgctctccatcaacagatacgaaaggaagaaaaatctgactttggcactggaagccctagtacagctgcgtggaagattgacatcccaagattgggagagggttcatctgatcgtggcaggtggttatgacgagagagtcctggagaatgtggaacattatcaggaattgaagaaaatggtccaacagtccgaccttggccagtatgtgaccttcttgaggtctttctcagacaaacagaaaatctccctcctccacagctgcacgtgtgtgctttacacaccaagcaatgagcactttggcattgtccctctggaagccatgtacatgcagtgcccagtcattgctgttaattcgggtggacccttggagtccattgaccacagtgtcacagggtttctgtgtgagcctgacccggtgcacttctcagaagcaatagaaaagttcatccgtgaaccttccttaaaagccaccatgggcctggctggaagagccagagtgaaggaaaaattttcccctgaagcatttacagaacagctctaccgatatgttaccaaactgctggtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B - guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 - TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa |