Login to display prices
Login to display prices
ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene View larger

ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene

PTXBC015126

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC015126
Ncbi symbol: ALG2
Product name: ALG2-asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC015126
Gene id: 85365
Gene description: asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
Synonyms: ALG2, alpha-1,3/1,6-mannosyltransferase; homolog of yeast ALG2; alpha-1,3-mannosyltransferase ALG2; alpha-1,3/1,6-mannosyltransferase ALG2; CDGIi; CMS14; CMSTA3; NET38; hALPG2; GDP-Man:Man(1)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase; GDP-Man:Man(1)GlcNAc(2)-PP-dolichol mannosyltransferase; GDP-Man:Man(2)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase; asparagine-linked glycosylation 2 homolog (S. cerevisiae, alpha-1,3-mannosyltransferase); asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase); asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog; asparagine-linked glycosylation protein 2 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagactgcatcttagtcaacagccagttcacagctgctgtttttaaggaaacattcaagtccctgtctcacatagaccctgatgtcctctatccatctctaaatgtcaccagctttgactcagttgttcctgaaaagctggatgacctagtccccaaggggaaaaaattcctgctgctctccatcaacagatacgaaaggaagaaaaatctgactttggcactggaagccctagtacagctgcgtggaagattgacatcccaagattgggagagggttcatctgatcgtggcaggtggttatgacgagagagtcctggagaatgtggaacattatcaggaattgaagaaaatggtccaacagtccgaccttggccagtatgtgaccttcttgaggtctttctcagacaaacagaaaatctccctcctccacagctgcacgtgtgtgctttacacaccaagcaatgagcactttggcattgtccctctggaagccatgtacatgcagtgcccagtcattgctgttaattcgggtggacccttggagtccattgaccacagtgtcacagggtttctgtgtgagcctgacccggtgcacttctcagaagcaatagaaaagttcatccgtgaaccttccttaaaagccaccatgggcctggctggaagagccagagtgaaggaaaaattttcccctgaagcatttacagaacagctctaccgatatgttaccaaactgctggtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: