Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PCBD2-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 Gene
PTXBC054021
New product
Data sheet of PCBD2-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PCBD2-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC054021 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PCBD2 |
| Origin species: | Human |
| Product name: | PCBD2-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 Gene |
| Size: | 2ug |
| Accessions: | BC054021 |
| Gene id: | 84105 |
| Gene description: | pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 |
| Synonyms: | DCOH2; DCOHM; PHS2; pterin-4-alpha-carbinolamine dehydratase 2; 4-alpha-hydroxy-tetrahydropterin dehydratase 2; 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2; DcoH-like protein DCoHm; HNF-1-alpha dimerization cofactor; PHS 2; dimerization cofactor of hepatocyte nuclear factor 1 (HNF1) from muscle; dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1); dimerization cofactor of hepatocyte nuclear factor 1 from muscle; pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2; pterin-4 alpha-carbinolamine dehydratase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggtgctcggggcgctcggggcgacgcggcgcttgttggcggcgctgcgaggccagagcctagggctagcggccatgtcatcaggtactcacaggttgactgcagaggagaggaaccaagctatacttgaccttaaagcagcaggatggtcggaattaagtgagagagatgccatctacaaagaattctccttccacaattttaatcaggcatttggctttatgtcccgagttgccctacaagcagagaagatgaatcatcacccagaatggttcaatgtatacaacaaggtccagataactctcacctcacatgactgtggtgaactgaccaaaaaagatgtgaagctggccaagtttattgaaaaagcagctgcttctgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase) pseudogene - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 - sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B |