Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
B4GALT7-xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) Gene
PTXBC007317
New product
Data sheet of B4GALT7-xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about B4GALT7-xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007317 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | B4GALT7 |
| Origin species: | Human |
| Product name: | B4GALT7-xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) Gene |
| Size: | 2ug |
| Accessions: | BC007317 |
| Gene id: | 11285 |
| Gene description: | xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) |
| Synonyms: | EDSP1; EDSSLA; XGALT1; XGPT1; beta-1,4-galactosyltransferase 7; UDP-Gal:beta-GlcNAc beta-1,4-galactosyltransferase 7; UDP-galactose:beta-N-acetylglucosamine beta-1,4-galactosyltransferase 7; beta-1,4-GalTase 7; beta-1,4-galactosyltransferase VII; beta4Gal-T7; beta4GalT-VII; galactosyltransferase I; proteoglycan UDP-galactose:beta-xylose beta1,4-galactosyltransferase I; xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcccctcgcggaggaaagcggcgcagctgccctgggaggacggcaggtccgggttgctctccggcggcctccctcggaagtgttccgtcttccacctgttcgtggcctgcctctcgctgggcttcttctccctactctggctgcagctcagctgctctggggacgtggcccgggcagtcaggggacaagggcaggagacctcgggccctccccgcgcctgccccccagagccgccccctgagcactgggaagaagacgcatcctggggcccccaccgcctggcagtgctggtgcccttccgcgaacgcttcgaggagctcctggtcttcgtgccccacatgcgccgcttcctgagcaggaagaagatccggcaccacatctacgtgctcaaccaggtggaccacttcaggttcaaccgggcagcgctcatcaacgtgggcttcctggagagcagcaacagcacggactacattgccatgcacgacgttgacctgctccctctcaacgaggagctggactatggctttcctgaggctgggcccttccacgtggcctccccggagctccaccctctctaccactacaagacctatgtcggcggcatcctgctgctctccaagcagcactaccggctgtgcaatgggatgtccaaccgcttctggggctggggccgcgaggacgacgagttctaccggcgcattaagggagctgggctccagcttttccgcccctcgggaatcacaactgggtacaagacatttcgccacctgcatgacccagcctggcggaagagggaccagaagcgcatcgcagctcaaaaacaggagcagttcaaggtggacagggagggaggcctgaacactgtgaagtaccatgtggcttcccgcactgccctgtctgtgggcggggccccctgcactgtcctcaacatcatgttggactgtgacaagaccgccacaccctggtgcacattcagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) - pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 - cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase) pseudogene - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 |