Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AP3S1-adaptor-related protein complex 3, sigma 1 subunit Gene
PTXBC000804
New product
Data sheet of AP3S1-adaptor-related protein complex 3, sigma 1 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP3S1-adaptor-related protein complex 3, sigma 1 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000804 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP3S1 |
| Origin species: | Human |
| Product name: | AP3S1-adaptor-related protein complex 3, sigma 1 subunit Gene |
| Size: | 2ug |
| Accessions: | BC000804 |
| Gene id: | 1176 |
| Gene description: | adaptor-related protein complex 3, sigma 1 subunit |
| Synonyms: | CLAPS3; Sigma3A; AP-3 complex subunit sigma-1; adapter-related protein complex 3 subunit sigma-1; adaptor-related protein complex 3 subunit sigma-1; clathrin adaptor complex AP3, sigma-3A subunit; clathrin-associated/assembly/adapter protein, small 3; clathrin-associated/assembly/adaptor protein, small 3 (22kD); sigma-adaptin 3a; adaptor related protein complex 3 sigma 1 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcaaggcgatcctaatcttcaacaaccacgggaagccgcggctctccaagttctaccagccctacagtgaagatacacaacagcaaatcatcagggagactttccatttggtatctaagagagatgaaaatgtttgtaatttcctagaaggaggattattaattggaggatctgacaacaaactgatttatagacattatgcaacgttatattttgtcttctgtgtggattcttcagaaagtgaacttggcattttagatctaattcaagtatttgtggaaacattagacaaatgttttgaaaatgtctgtgagctggatttgattttccatgtagacaaggttcacaatattcttgcagaaatggtgatggggggaatggtattggagacaaatatgaatgagattgttacacaaattgatgcacaaaataagctggaaaaatctgaggctggcttagcaggagctccagcccgtgctgtatcagctgtaaagaatatgaatcttcctgagatcccaagaaatattaacattggtgacatcagtataaaagtgccaaacctgccctcttttaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATG10 autophagy related 10 homolog (S. cerevisiae) - ORAI calcium release-activated calcium modulator 1 - heterogeneous nuclear ribonucleoprotein C (C1/C2) - lipid phosphate phosphatase-related protein type 2 |