PTXBC029268
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029268 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATG10 |
| Origin species: | Human |
| Product name: | ATG10-ATG10 autophagy related 10 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC029268 |
| Gene id: | 83734 |
| Gene description: | ATG10 autophagy related 10 homolog (S. cerevisiae) |
| Synonyms: | ATG10 autophagy related 10 homolog; ubiquitin-like-conjugating enzyme ATG10; APG10; APG10L; pp12616; APG10 autophagy 10-like; autophagy-related protein 10; autophagy related 10 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagaagatgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacagataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatctaggagcatctacccatggacagacatgtcttcccatggaggaggctttcgagctacccttggatgattgtgaagtgattgaaactgcagcagcgtccgaagtgattaaatatgagtatcatgtcttatattcctgtagctaccaagtgcctgtactttactttagggcaagctttttagatgggagacctttaactctgaaggacatatgggaaggagttcatgagtgctataagatgcgactgctacagggaccatgggacactattacgcaacaggaacatccaatacttgggcaacccttttttgtacttcatccctgcaagacgaatgaattcatgactcctgtattaaagaattctcagaaaatcaataagaatgtcaactatatcacatcatggctgagcattgtagggccagttgttgggctgaatctacctctgagttatgccaaagcaacgtctcaggatgaacgaaatgtcccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ORAI calcium release-activated calcium modulator 1 - heterogeneous nuclear ribonucleoprotein C (C1/C2) - lipid phosphate phosphatase-related protein type 2 - vesicle-associated membrane protein 8 (endobrevin) |