Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ORAI1-ORAI calcium release-activated calcium modulator 1 Gene
PTXBC013386
New product
Data sheet of ORAI1-ORAI calcium release-activated calcium modulator 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ORAI1-ORAI calcium release-activated calcium modulator 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013386 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ORAI1 |
| Origin species: | Human |
| Product name: | ORAI1-ORAI calcium release-activated calcium modulator 1 Gene |
| Size: | 2ug |
| Accessions: | BC013386 |
| Gene id: | 84876 |
| Gene description: | ORAI calcium release-activated calcium modulator 1 |
| Synonyms: | CRACM1; IMD9; ORAT1; TAM2; TMEM142A; calcium release-activated calcium channel protein 1; calcium release-activated calcium modulator 1; protein orai-1; transmembrane protein 142A; ORAI calcium release-activated calcium modulator 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcctcaacgagcactccatgcaggcgctgtcctggcgcaagctctacttgagccgcgccaagcttaaagcctccagccggacctcggctctgctctccggcttcgccatggtggcaatggtggaggtgcagctggacgctgaccacgactacccaccggggctgctcatcgccttcagtgcctgcaccacagtgctggtggctgtgcacctgtttgcgctcatgatcagcacctgcatcctgcccaacatcgaggcggtgagcaacgtgcacaatctcaactcggtcaaggagtccccccatgagcgcatgcaccgccacatcgagctggcctgggccttctccaccgtcatcggcacgctgctcttcctagctgaggtggtgctgctctgctgggtcaagttcttgcccctcaagaagcagccaggccagccaaggcccaccagcaagccccccgccggtggcgcagcagccaacgtcagcaccagcggcatcaccccgggccaggcagccgccatcgcctcgaccaccatcatggtgcccttcggcctgatctttatcgtcttcgccgtccacttctaccgctcactggtcagccataagaccgaccgacagttccaggagctcaacgagctggcggagtttgcccgcttacaggaccagctggaccacagaggggaccaccccctgacgcccggcagccactatgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heterogeneous nuclear ribonucleoprotein C (C1/C2) - lipid phosphate phosphatase-related protein type 2 - vesicle-associated membrane protein 8 (endobrevin) - RanBP-type and C3HC4-type zinc finger containing 1 |