PTXBC001634
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC001634 |
Product type: | DNA & cDNA |
Ncbi symbol: | VAMP8 |
Origin species: | Human |
Product name: | VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene |
Size: | 2ug |
Accessions: | BC001634 |
Gene id: | 8673 |
Gene description: | vesicle-associated membrane protein 8 (endobrevin) |
Synonyms: | EDB; VAMP-8; vesicle-associated membrane protein 8; vesicle-associated membrane protein 8 (endobrevin); vesicle associated membrane protein 8 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggaggaagccagtgaaggtggaggaaatgatcgtgtgcggaacctgcaaagtgaggtggagggagttaagaatattatgacccagaatgtggagcggatcctggcccggggggaaaacttggaacatctccgcaacaagacagaggatctggaagccacatctgagcacttcaagacgacatcgcagaaggtggctcggaaattctggtggaagaacgtgaagatgattgtccttatctgcgtgattgtttttatcatcatcctcttcattgtgctctttgccactggtgccttctcttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - RanBP-type and C3HC4-type zinc finger containing 1 - SMEK homolog 1, suppressor of mek1 (Dictyostelium) - agouti signaling protein, nonagouti homolog (mouse) - proteolipid protein 2 (colonic epithelium-enriched) |