No products
Prices are tax excluded
PTXBC001634
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001634 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAMP8 |
| Origin species: | Human |
| Product name: | VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene |
| Size: | 2ug |
| Accessions: | BC001634 |
| Gene id: | 8673 |
| Gene description: | vesicle-associated membrane protein 8 (endobrevin) |
| Synonyms: | EDB; VAMP-8; vesicle-associated membrane protein 8; vesicle-associated membrane protein 8 (endobrevin); vesicle associated membrane protein 8 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggaagccagtgaaggtggaggaaatgatcgtgtgcggaacctgcaaagtgaggtggagggagttaagaatattatgacccagaatgtggagcggatcctggcccggggggaaaacttggaacatctccgcaacaagacagaggatctggaagccacatctgagcacttcaagacgacatcgcagaaggtggctcggaaattctggtggaagaacgtgaagatgattgtccttatctgcgtgattgtttttatcatcatcctcttcattgtgctctttgccactggtgccttctcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - RanBP-type and C3HC4-type zinc finger containing 1 - SMEK homolog 1, suppressor of mek1 (Dictyostelium) - agouti signaling protein, nonagouti homolog (mouse) - proteolipid protein 2 (colonic epithelium-enriched) |