VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene View larger

VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001634
Product type: DNA & cDNA
Ncbi symbol: VAMP8
Origin species: Human
Product name: VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene
Size: 2ug
Accessions: BC001634
Gene id: 8673
Gene description: vesicle-associated membrane protein 8 (endobrevin)
Synonyms: EDB; VAMP-8; vesicle-associated membrane protein 8; vesicle-associated membrane protein 8 (endobrevin); vesicle associated membrane protein 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaagccagtgaaggtggaggaaatgatcgtgtgcggaacctgcaaagtgaggtggagggagttaagaatattatgacccagaatgtggagcggatcctggcccggggggaaaacttggaacatctccgcaacaagacagaggatctggaagccacatctgagcacttcaagacgacatcgcagaaggtggctcggaaattctggtggaagaacgtgaagatgattgtccttatctgcgtgattgtttttatcatcatcctcttcattgtgctctttgccactggtgccttctcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RanBP-type and C3HC4-type zinc finger containing 1
- SMEK homolog 1, suppressor of mek1 (Dictyostelium)
- agouti signaling protein, nonagouti homolog (mouse)
- proteolipid protein 2 (colonic epithelium-enriched)

Buy VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene now

Add to cart