Login to display prices
Login to display prices
LPPR2-lipid phosphate phosphatase-related protein type 2 Gene View larger

LPPR2-lipid phosphate phosphatase-related protein type 2 Gene

PTXBC009378

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LPPR2-lipid phosphate phosphatase-related protein type 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LPPR2-lipid phosphate phosphatase-related protein type 2 Gene

Proteogenix catalog: PTXBC009378
Ncbi symbol: LPPR2
Product name: LPPR2-lipid phosphate phosphatase-related protein type 2 Gene
Size: 2ug
Accessions: BC009378
Gene id: 64748
Gene description: lipid phosphate phosphatase-related protein type 2
Synonyms: LPPR2; PRG4; phospholipid phosphatase-related protein type 2; PRG-4; lipid phosphate phosphatase-related protein type 2; plasticity related gene 4; plasticity-related gene 4 protein; phospholipid phosphatase related 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggagggagaccgcatctgaagaggagtttctccatcatcccctgctttgtcttcgtggagtcggtgctgctgggcattgtgatcctgcttgcttaccgcctggagttcacggacaccttccctgtgcacacccagggattcttctgctatgacagtacctacgccaagccctacccagggcctgaggctgccagccgagtgcctcctgctcttgtctacgcactggtcactgccgggcccaccctcacgatcctgctgggagagctggcgcgtgcctttttccctgcaccaccttcagccgtcccagtcatcggggagagcaccatcgtgtctggggcctgctgccgcttcagccccccagtgcggaggctggtccgcttcctgggggtctactccttcggcctcttcaccacgaccatcttcgccaacgcggggcaggtggtgaccggcaatcccacgccacacttcctgtccgtgtgccgccccaactacacggccctgggctgcctgccaccttctccggatcggccaggtcccgaccgctttgtcactgaccagggtgcctgcgctggcagtcccagcctcgtggccgccgcgcgccgcgccttcccctgcaaggatgcggccctctgcgcctacgcggtcacctacacagcgatgtacgtgactctcgtgttccgcgtgaagggctcccgcctggtcaaaccctcgctctgcctggccttgctgtgcccggccttcctggtgggcgtggtccgcgtggccgagtaccgaaaccactggtcggacgtgctggctggcttcctgacaggggcggccatcgccacctttttggtcacctgcgttgtgcataactttcagagccggccaccctctggccgaaggctctctccctgggaggacctgggccaagcccccaccatggatagccccctcgaaaagaacccgaggtctgcaggccgcattcgacaccggcacggctcaccccatccaagtcgcagaactgcgcccgccgtggccacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: