Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LPPR2-lipid phosphate phosphatase-related protein type 2 Gene
PTXBC009378
New product
Data sheet of LPPR2-lipid phosphate phosphatase-related protein type 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LPPR2-lipid phosphate phosphatase-related protein type 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009378 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LPPR2 |
| Origin species: | Human |
| Product name: | LPPR2-lipid phosphate phosphatase-related protein type 2 Gene |
| Size: | 2ug |
| Accessions: | BC009378 |
| Gene id: | 64748 |
| Gene description: | lipid phosphate phosphatase-related protein type 2 |
| Synonyms: | LPPR2; PRG4; phospholipid phosphatase-related protein type 2; PRG-4; lipid phosphate phosphatase-related protein type 2; plasticity related gene 4; plasticity-related gene 4 protein; phospholipid phosphatase related 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggagggagaccgcatctgaagaggagtttctccatcatcccctgctttgtcttcgtggagtcggtgctgctgggcattgtgatcctgcttgcttaccgcctggagttcacggacaccttccctgtgcacacccagggattcttctgctatgacagtacctacgccaagccctacccagggcctgaggctgccagccgagtgcctcctgctcttgtctacgcactggtcactgccgggcccaccctcacgatcctgctgggagagctggcgcgtgcctttttccctgcaccaccttcagccgtcccagtcatcggggagagcaccatcgtgtctggggcctgctgccgcttcagccccccagtgcggaggctggtccgcttcctgggggtctactccttcggcctcttcaccacgaccatcttcgccaacgcggggcaggtggtgaccggcaatcccacgccacacttcctgtccgtgtgccgccccaactacacggccctgggctgcctgccaccttctccggatcggccaggtcccgaccgctttgtcactgaccagggtgcctgcgctggcagtcccagcctcgtggccgccgcgcgccgcgccttcccctgcaaggatgcggccctctgcgcctacgcggtcacctacacagcgatgtacgtgactctcgtgttccgcgtgaagggctcccgcctggtcaaaccctcgctctgcctggccttgctgtgcccggccttcctggtgggcgtggtccgcgtggccgagtaccgaaaccactggtcggacgtgctggctggcttcctgacaggggcggccatcgccacctttttggtcacctgcgttgtgcataactttcagagccggccaccctctggccgaaggctctctccctgggaggacctgggccaagcccccaccatggatagccccctcgaaaagaacccgaggtctgcaggccgcattcgacaccggcacggctcaccccatccaagtcgcagaactgcgcccgccgtggccacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vesicle-associated membrane protein 8 (endobrevin) - RanBP-type and C3HC4-type zinc finger containing 1 - SMEK homolog 1, suppressor of mek1 (Dictyostelium) - agouti signaling protein, nonagouti homolog (mouse) |