LPPR2-lipid phosphate phosphatase-related protein type 2 Gene View larger

LPPR2-lipid phosphate phosphatase-related protein type 2 Gene

PTXBC009378

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LPPR2-lipid phosphate phosphatase-related protein type 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LPPR2-lipid phosphate phosphatase-related protein type 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009378
Product type: DNA & cDNA
Ncbi symbol: LPPR2
Origin species: Human
Product name: LPPR2-lipid phosphate phosphatase-related protein type 2 Gene
Size: 2ug
Accessions: BC009378
Gene id: 64748
Gene description: lipid phosphate phosphatase-related protein type 2
Synonyms: LPPR2; PRG4; phospholipid phosphatase-related protein type 2; PRG-4; lipid phosphate phosphatase-related protein type 2; plasticity related gene 4; plasticity-related gene 4 protein; phospholipid phosphatase related 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggagggagaccgcatctgaagaggagtttctccatcatcccctgctttgtcttcgtggagtcggtgctgctgggcattgtgatcctgcttgcttaccgcctggagttcacggacaccttccctgtgcacacccagggattcttctgctatgacagtacctacgccaagccctacccagggcctgaggctgccagccgagtgcctcctgctcttgtctacgcactggtcactgccgggcccaccctcacgatcctgctgggagagctggcgcgtgcctttttccctgcaccaccttcagccgtcccagtcatcggggagagcaccatcgtgtctggggcctgctgccgcttcagccccccagtgcggaggctggtccgcttcctgggggtctactccttcggcctcttcaccacgaccatcttcgccaacgcggggcaggtggtgaccggcaatcccacgccacacttcctgtccgtgtgccgccccaactacacggccctgggctgcctgccaccttctccggatcggccaggtcccgaccgctttgtcactgaccagggtgcctgcgctggcagtcccagcctcgtggccgccgcgcgccgcgccttcccctgcaaggatgcggccctctgcgcctacgcggtcacctacacagcgatgtacgtgactctcgtgttccgcgtgaagggctcccgcctggtcaaaccctcgctctgcctggccttgctgtgcccggccttcctggtgggcgtggtccgcgtggccgagtaccgaaaccactggtcggacgtgctggctggcttcctgacaggggcggccatcgccacctttttggtcacctgcgttgtgcataactttcagagccggccaccctctggccgaaggctctctccctgggaggacctgggccaagcccccaccatggatagccccctcgaaaagaacccgaggtctgcaggccgcattcgacaccggcacggctcaccccatccaagtcgcagaactgcgcccgccgtggccacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vesicle-associated membrane protein 8 (endobrevin)
- RanBP-type and C3HC4-type zinc finger containing 1
- SMEK homolog 1, suppressor of mek1 (Dictyostelium)
- agouti signaling protein, nonagouti homolog (mouse)

Buy LPPR2-lipid phosphate phosphatase-related protein type 2 Gene now

Add to cart