ORC5L-origin recognition complex, subunit 5-like (yeast) Gene View larger

ORC5L-origin recognition complex, subunit 5-like (yeast) Gene

PTXBC023652

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ORC5L-origin recognition complex, subunit 5-like (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ORC5L-origin recognition complex, subunit 5-like (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023652
Product type: DNA & cDNA
Ncbi symbol: ORC5L
Origin species: Human
Product name: ORC5L-origin recognition complex, subunit 5-like (yeast) Gene
Size: 2ug
Accessions: BC023652
Gene id: 5001
Gene description: origin recognition complex, subunit 5-like (yeast)
Synonyms: ORC5L; ORC5P; ORC5T; PPP1R117; origin recognition complex subunit 5; protein phosphatase 1, regulatory subunit 117
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccacttggaaaacgtggtgctttgtcgcgagtctcaagtgtccatcttgcagtccttgtttggagagagacatcatttcagctttccatccatttttatttatggacatactgctagtggaaagacctatgtaacacaaacgttgttgaaaactttagagctcccacatgtgtttgtgaattgtgttgaatgctttacattgaggctgcttttggaacaaattttaaacaaattgaatcatcttagttcttcagaggatggatgttctactgaaataacctgtgaaacatttaatgactttgttcgcttgtttaaacaagtaaccacagctgaaaatcttaaagatcagactgtatatattgttctagataaagcagagtatctaagagatatggaagcaaatcttttgcctggatttcttagattacaagaattggctgacagaaatgtgactgttctctttctcagtgaaattgtttgggaaaagtttcgtccaaatactggatgctttgagccgtttgtcttatatttccctgattacagcataggcaaccttcaaaagatcctgtcccatgatcatcctccagagtattcagctgatttctatgctgcctacattaacattcttcttggagttttctacactgtttgtcgagatttgaaagagctcagacatctggcagtacttaattttcctaaatattgtgaacccgtggttaaaggagaagcaagtgaacgtgatactcgcaaactgtggagaaatattgaacctcatttgaagaaagctatgcagactgtttatctcagggaaatatcaagttcccagtgggaaaagctacagaaagatgacacagatccggggcaactgaaaggcctctcagcgcatactcatgtggaacttccatattactctaagttcattctaattgctgcataccttgcttcatacaatccagcaagaactgacaagaggttttttcttaagcatcatggaaaaatcaagaaaaccaactttctaaaaaaacacgaaaagacaagcaatcatctccttgggccaaaaccatttccactagacagattattagcaatattatatagtatcgtggacagcagagttgctccaacagcaaatattttttcccagattacctctctagtgacccttcagctgttaaccctggttggccatgacgatcagcttgatggaccaaaatacaaatgcacagtgtctctagacttcatcagagctattgcaaggacggtgaactttgacataataaaatacttgtatgatttcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant gamma 1 (G1m marker)
- immunoglobulin heavy constant gamma 1 (G1m marker)
- small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
- membrane-spanning 4-domains, subfamily A, member 7

Buy ORC5L-origin recognition complex, subunit 5-like (yeast) Gene now

Add to cart