Login to display prices
Login to display prices
IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene View larger

IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

PTXBC025314

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

Proteogenix catalog: PTXBC025314
Ncbi symbol: IGHG1
Product name: IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene
Size: 2ug
Accessions: BC025314
Gene id: 3500
Gene description: immunoglobulin heavy constant gamma 1 (G1m marker)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactggacctggaggttcctctttgtggtggcagcagctacaagtgtccagtcccaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggagactccttcaacagtcttgctatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacaacaaattacgcacagaggttccagggcagagtcacgtttaccgcggacgaatccacgggcagagcctacatggagctgaccagcctcagatctgaggacacggccgtatattactgtgcgagccgttttataagtgaaactaatttttgctttaaattctggggccagggaacgctggtcaccgtctcctcagcctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacccagacctacatctgcaacgtgaatcacaagcccagcaacaccaaggtggacaagaaagttgagcccaaatcttgtgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: