IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene View larger

IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025314
Product type: DNA & cDNA
Ncbi symbol: IGHG1
Origin species: Human
Product name: IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene
Size: 2ug
Accessions: BC025314
Gene id: 3500
Gene description: immunoglobulin heavy constant gamma 1 (G1m marker)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactggacctggaggttcctctttgtggtggcagcagctacaagtgtccagtcccaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggagactccttcaacagtcttgctatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacaacaaattacgcacagaggttccagggcagagtcacgtttaccgcggacgaatccacgggcagagcctacatggagctgaccagcctcagatctgaggacacggccgtatattactgtgcgagccgttttataagtgaaactaatttttgctttaaattctggggccagggaacgctggtcaccgtctcctcagcctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacccagacctacatctgcaacgtgaatcacaagcccagcaacaccaaggtggacaagaaagttgagcccaaatcttgtgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant gamma 1 (G1m marker)
- small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
- membrane-spanning 4-domains, subfamily A, member 7
- lymphatic vessel endothelial hyaluronan receptor 1

Buy IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene now

Add to cart