Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LYVE1-lymphatic vessel endothelial hyaluronan receptor 1 Gene
PTXBC026231
New product
Data sheet of LYVE1-lymphatic vessel endothelial hyaluronan receptor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LYVE1-lymphatic vessel endothelial hyaluronan receptor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026231 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LYVE1 |
| Origin species: | Human |
| Product name: | LYVE1-lymphatic vessel endothelial hyaluronan receptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC026231 |
| Gene id: | 10894 |
| Gene description: | lymphatic vessel endothelial hyaluronan receptor 1 |
| Synonyms: | CRSBP-1; HAR; LYVE-1; XLKD1; lymphatic vessel endothelial hyaluronic acid receptor 1; cell surface retention sequence binding protein-1; extracellular link domain-containing 1; extracellular link domain-containing protein 1; hyaluronic acid receptor; lymphatic vessel endothelial hyaluronan receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaggtgcttcagcctggtgttgcttctcacttccatctggaccacgaggctcctggtccaaggctctttgcgtgcagaagagctttccatccaggtgtcatgcagaattatggggatcacccttgtgagcaaaaaggcgaaccagcagctgaatttcacagaagctaaggaggcctgtaggctgctgggactaagtttggccggcaaggaccaagttgaaacagccttgaaagctagctttgaaacttgcagctatggctgggttggagatggattcgtggtcatctctaggattagcccaaaccccaagtgtgggaaaaatggggtgggtgtcctgattaggaaggttccagtgagccgacagtttgcagcctattgttacaactcatctgatacttggactaactcgtgcattccagaaattatcaccaccaaagatcccatattcaacactcaaactgcaacacaaacaacagaatttattgtcagtgacagtacctactcggtggcatccccttactctacaatacctgcccctactactactcctcctgctccagcttccacttctattccacggagaaaaaaattgatttgtgtcacagaagtttttatggaaactagcaccatgtctacagaaactgaaccatttgttgaaaataaagcagcattcaagaatgaagctgctgggtttggaggtgtccccacggctctgctagtgcttgctctcctcttctttggtgctgcagctggtcttggattttgctatgtcaaaaggtatgtgaaggccttcccttttacaaacaagaatcagcagaaggaaatgatcgaaaccaaagtagtaaaggaggagaaggccaatgatagcaaccctaatgaggaatcaaagaaaactgataaaaacccagaagagtccaagagtccaagcaaaactaccgtgcgatgcctggaagctgaagtttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATG4 autophagy related 4 homolog A (S. cerevisiae) - polymerase (DNA-directed), epsilon 4 (p12 subunit) - basic transcription factor 3, pseudogene 9 - ATG10 autophagy related 10 homolog (S. cerevisiae) |