Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATG4A-ATG4 autophagy related 4 homolog A (S. cerevisiae) Gene
PTXBC061696
New product
Data sheet of ATG4A-ATG4 autophagy related 4 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATG4A-ATG4 autophagy related 4 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC061696 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATG4A |
| Origin species: | Human |
| Product name: | ATG4A-ATG4 autophagy related 4 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC061696 |
| Gene id: | 115201 |
| Gene description: | ATG4 autophagy related 4 homolog A (S. cerevisiae) |
| Synonyms: | cysteine protease ATG4A; APG4A; AUTL2; APG4 autophagy 4 homolog A; ATG4 autophagy related 4 homolog A; AUT-like 2, cysteine endopeptidase; autophagin 2; autophagy-related cysteine endopeptidase 2; autophagy-related protein 4 homolog A; hAPG4A; autophagy related 4A cysteine peptidase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtcagttttatccaagtatgaagatcagattactattttcactgactacctagaagaatatccagatacagatgagctggtatggatcttagggaagcagcatctccttaaaacagaaaaatctaagctgttgtctgatataagtgctcgtctatggtttacatacagaaggaaattttcaccaattggtggaacgggcccttcatcagatgctggttggggatgtatgctacgctgtggacagatgatgctggctcaagcccttatctgtagacacttgggaagggactggagctgggagaaacaaaaagaacaacccaaagaataccaacgcatcctacagtgcttcttagatagaaaagattgttgctactctatccatcaaatggcacaaatgggtgtaggagaagggaaatcaattggagaatggtttggaccaaatacagttgcacaggtgttaaaaaaacttgctttatttgacgaatggaattccttggctgtttatgtttcaatggataacacagtggtcattgaagatatcaaaaaaatgtgccgtgtccttcccttgagtgctgacacagctggtgacaggcctcccgattctttaactgcttcaaaccagagtaagggcacctctgcctactgctcagcctggaaacccctgctgctcattgtgccccttcgcctgggcataaaccaaatcaatcctgtctatgttgatgcattcaaagagtgttttaagatgccacagtctttaggggcattaggaggaaaaccaaataacgcgtattatttcataggattcttaggtgacgagctcatcttcttggaccctcatacaacccagacctttgttgacactgaagagaatggaacggttaatgaccagactttccattgcctgcagtccccacagcgaatgaacatcctaaacctggatccttcagttgcattgggatttttctgcaaagaagaaaaagactttgataactggtgtagccttgttcagaaggaaattctaaaggagaatttaaggatgtttgaattagttcagaaacatccatcacactggcctccctttgtacctccagccaagccagaagtgacaaccactggggcagaattcattgactctactgagcaactggaggagtttgatctggaggaagattttgagattctgagtgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (DNA-directed), epsilon 4 (p12 subunit) - basic transcription factor 3, pseudogene 9 - ATG10 autophagy related 10 homolog (S. cerevisiae) - immunoglobulin heavy constant gamma 2 (G2m marker) |