Login to display prices
Login to display prices
IGHG2-immunoglobulin heavy constant gamma 2 (G2m marker) Gene View larger

IGHG2-immunoglobulin heavy constant gamma 2 (G2m marker) Gene

PTXBC062335

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGHG2-immunoglobulin heavy constant gamma 2 (G2m marker) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IGHG2-immunoglobulin heavy constant gamma 2 (G2m marker) Gene

Proteogenix catalog: PTXBC062335
Ncbi symbol: IGHG2
Product name: IGHG2-immunoglobulin heavy constant gamma 2 (G2m marker) Gene
Size: 2ug
Accessions: BC062335
Gene id: 3501
Gene description: immunoglobulin heavy constant gamma 2 (G2m marker)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaattggggctgaactgggttctccttgttgctattttagaaggtgtccagtgtgaggtgcaactaatggagtctgcgggaggcttggtcaagcctggggggtccctgagactctcctgtgcagcctctgggttcttctttagtgaatattggatgagttgggtccgccaggctccagggaaggggctggagtgggtggccaatataaaagacgatggaagtgcgacatatcatttggactctgtgaagggccgattcaccatctccagagacaatgccaggaacaccctttatctgcagatgaacagcctgagagtcgaggatacggctatgtactactgtgcgagagagatcccggggggccggtgcttttacgacttttggggtcatggaacattggtcaccgtttcctcagcctccaccaagggcccatcggtcttccccctggcgccctgctccaggagcacctccgagagcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgctctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcaacttcggcacccagacctacacctgcaacgtagatcacaagcccagcaacaccaaggtggacaagacagttgagcgcaaatgttgtgtcgagtgcccaccgtgcccagcaccacctgtggcaggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacgtgcgtggtggtggacgtgagccacgaagaccccgaggtccagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccacgggaggagcagttcaacagcacgttccgtgtggtcagcgtcctcaccgtcgtgcaccaggactggctgaacggcaaggagtacaagtgcaaggtctccaacaaaggcctcccagcccccatcgagaaaaccatctccaaaaccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggaggagatgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaacaccacacctcccatgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: