IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene View larger

IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC067091
Product type: DNA & cDNA
Ncbi symbol: IGHG1
Origin species: Human
Product name: IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene
Size: 2ug
Accessions: BC067091
Gene id: 3500
Gene description: immunoglobulin heavy constant gamma 1 (G1m marker)
Synonyms: CD154; CD40L; HIGM1; IGM; IMD3; T-BAM; TNFSF5; TRAP; gp39; hCD40L; CD40 antigen ligand; CD40-L; T-B cell-activating molecule; T-cell antigen Gp39; TNF-related activation protein; tumor necrosis factor (ligand) superfamily member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactggacctggaggttcctctttgtggtggcagcagttacaggtgtccagtcccaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcagtgaaggtctcctgcaaggcctctggagacaccttcactaactatgctatcagctgggtacgacaggcccctggacaaggacttgagtggatgggggggatcatccctatctttggaacaacagactacgcacagaatttccaggacagagtcacaattaccgcggacgaatctacgaatttattctctctggaaataaataacctgagatctaaagacacggccatgtattattgtgtgagagagtccttcactacggtttttggagtgccgaccctccattaccttgactcctggggccagggaacgctggtcaccgtctcctcagcctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacccagacctacatctgcaacgtgaatcacaagcccagcaacaccaaggtggacaagaaagttgagcccaaatcttgtgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant gamma 1 (G1m marker)
- immunoglobulin heavy constant gamma 1 (G1m marker)
- immunoglobulin heavy constant gamma 1 (G1m marker)
- origin recognition complex, subunit 3-like (yeast)

Buy IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene now

Add to cart