Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLE4-polymerase (DNA-directed), epsilon 4 (p12 subunit) Gene
PTXBC031331
New product
Data sheet of POLE4-polymerase (DNA-directed), epsilon 4 (p12 subunit) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLE4-polymerase (DNA-directed), epsilon 4 (p12 subunit) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031331 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLE4 |
| Origin species: | Human |
| Product name: | POLE4-polymerase (DNA-directed), epsilon 4 (p12 subunit) Gene |
| Size: | 2ug |
| Accessions: | BC031331 |
| Gene id: | 56655 |
| Gene description: | polymerase (DNA-directed), epsilon 4 (p12 subunit) |
| Synonyms: | YHHQ1; p12; DNA polymerase epsilon subunit 4; DNA polymerase II subunit 4; DNA polymerase epsilon p12 subunit; DNA polymerase epsilon subunit p12; polymerase (DNA) epsilon 4, accessory subunit; polymerase (DNA-directed), epsilon 4 (p12 subunit); polymerase (DNA-directed), epsilon 4, accessory subunit; DNA polymerase epsilon 4, accessory subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggcggcggcggcaggaagcgggacgccccgagaggaggaggtacctgctggggaggcagcggcctcgcagccccaggccccaacgagtgtgcctggggctcgtctctcgaggttgcctctggcgcgagtgaaggccttggtgaaggcagatcccgacgtgacgctagcgggacaggaagccatcttcattctggcacgagccgcggaactgtttgtggagaccattgcaaaagatgcctactgttgcgctcagcagggaaaaaggaaaacccttcagaggagagacttggataatgcaatagaagctgtggatgaatttgcttttctggaaggtactttagattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - basic transcription factor 3, pseudogene 9 - ATG10 autophagy related 10 homolog (S. cerevisiae) - immunoglobulin heavy constant gamma 2 (G2m marker) - immunoglobulin heavy constant gamma 1 (G1m marker) |