Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MS4A7-membrane-spanning 4-domains, subfamily A, member 7 Gene
PTXBC020673
New product
Data sheet of MS4A7-membrane-spanning 4-domains, subfamily A, member 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MS4A7-membrane-spanning 4-domains, subfamily A, member 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020673 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MS4A7 |
| Origin species: | Human |
| Product name: | MS4A7-membrane-spanning 4-domains, subfamily A, member 7 Gene |
| Size: | 2ug |
| Accessions: | BC020673 |
| Gene id: | 58475 |
| Gene description: | membrane-spanning 4-domains, subfamily A, member 7 |
| Synonyms: | 4SPAN2; CD20L4; CFFM4; MS4A8; membrane-spanning 4-domains subfamily A member 7; CD20 antigen-like 4; CD20/Fc-epsilon-RI-beta family member 4; four-span transmembrane protein 2; high affinity immunoglobulin epsilon receptor beta subunit; membrane spanning 4-domains A7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctattacaatcccaaaccatgggggtttctcacagctttacaccaaagggcatcactatccctcaaagagagaaacctggacacatgtaccaaaacgaagattacctgcagaacgggctgccaacagaaaccaccgttcttgggactgtccagatcctgtgttgcctgttgatttcaagtctgggggccatcttggtttttgctccctacccctcccacttcaatccagcaatttccaccactttgatgtctgggtacccatttttaggagctctgtgttttggcattactggatccctctcaattatctctggaaaacaatcaactaagccctttgacctgagcagcttgacctcaaatgcagtgagttctgttactgcaggagcaggcctcttcctccttgctgacagcatggtagccctgaggactgcctctcaacattgtggctcagaaatggattatctatcctcattgccttattcggagtactattatccaatatatgaaatcaaagattgtctcctgaccagtgtcagtttaacaggtgtcctagtggtgatgctcatcttcactgtgctggagctcttattagctgcatacagttctgtcttttggtggaaacagctctactccaacaaccctgggagttcattttcctcgacccagtcacaagatcatatccaacaggtcaaaaagagttcttcacggtcttggatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lymphatic vessel endothelial hyaluronan receptor 1 - ATG4 autophagy related 4 homolog A (S. cerevisiae) - polymerase (DNA-directed), epsilon 4 (p12 subunit) - basic transcription factor 3, pseudogene 9 |