Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNRH1-gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) Gene
PTXBC126437
New product
Data sheet of GNRH1-gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNRH1-gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126437 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNRH1 |
| Origin species: | Human |
| Product name: | GNRH1-gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) Gene |
| Size: | 2ug |
| Accessions: | BC126437 |
| Gene id: | 2796 |
| Gene description: | gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) |
| Synonyms: | GNRH; GRH; LHRH; LNRH; progonadoliberin-1; GnRH-associated peptide 1; gonadotropin-releasing hormone 1 (luteinizing-releasing hormone); leuteinizing-releasing hormone; luliberin I; prolactin release-inhibiting factor; gonadotropin releasing hormone 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagccaattcaaaaactcctagctggccttattctactgacttggtgcgtggaaggctgctccagccagcactggtcctatggactgcgccctggaggaaagagagatgccgaaaatttgattgattctttccaagagatagtcaaagaggttggtcaactggcagaaacccaacgcttcgaatgcaccacgcaccagccacgttctcccctccgagacctgaaaggagctctggaaagtctgattgaagaggaaactgggcagaagaagatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB, member of RAS oncogene family-like 2B - acyl-Coenzyme A binding domain containing 4 - putative homeodomain transcription factor 2 - twisted gastrulation homolog 1 (Drosophila) |