ACBD4-acyl-Coenzyme A binding domain containing 4 Gene View larger

ACBD4-acyl-Coenzyme A binding domain containing 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACBD4-acyl-Coenzyme A binding domain containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACBD4-acyl-Coenzyme A binding domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029164
Product type: DNA & cDNA
Ncbi symbol: ACBD4
Origin species: Human
Product name: ACBD4-acyl-Coenzyme A binding domain containing 4 Gene
Size: 2ug
Accessions: BC029164
Gene id: 79777
Gene description: acyl-Coenzyme A binding domain containing 4
Synonyms: HMFT0700; acyl-CoA-binding domain-containing protein 4; acyl-Coenzyme A binding domain containing 4; acyl-CoA binding domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaccgagaaagaaagcccagagcccgactgccagaaacagttccaggctgcagtgagcgtcatccagaacctgcccaagaacggttcttaccgcccctcctatgaagagatgctgcgattctacagttactacaagcaggccaccatggggccctgcctggtcccccggcccgggttctgggaccccattggacgatataagtgggacgcctggaacagtctgggcaagatgagcagggaggaggccatgtctgcctacatcactgaaatgaaactggtggcacagaaggtgatcgacacagtgcccctgggtgaggtggcagaggacatgtttggttacttcgagcccctgtaccaggtgatccctgacatgccgaggcccccagagaccttcctgagaagggtcacaggttggaaagagcaggttgtgaatggagatgttggggctgtttcagagcctccctgcctccccaaggaaccggcacccccaagcccagagtcccattcacccagggacctggactccgaggttttctgtgattccctggagcagctggagcctgagctggtttggacagagcagcgggcagcatctggaggaaagcgtgatcccaggaacagccccgtgccccccacaaagaaagaggggttgcggggcagcccgccggggccccaggagttggacgtgtggctgctggggacagttcgagcactacaggagagcatgcaggaggtgcaggcgagggtgcagagcctggagagcatgccccggccccctgagcagaggccgcagcccaggcccagtgctcggccatggccccttgggctcccggggcccgcgctgctcttcttcctcctgtggcccttcgtcgtccagtggctcttccgaatgtttcggacccaaaagaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - putative homeodomain transcription factor 2
- twisted gastrulation homolog 1 (Drosophila)
- fibroblast growth factor binding protein 2
- family with sequence similarity 3, member D

Buy ACBD4-acyl-Coenzyme A binding domain containing 4 Gene now

Add to cart