FGFBP2-fibroblast growth factor binding protein 2 Gene View larger

FGFBP2-fibroblast growth factor binding protein 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGFBP2-fibroblast growth factor binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FGFBP2-fibroblast growth factor binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025720
Product type: DNA & cDNA
Ncbi symbol: FGFBP2
Origin species: Human
Product name: FGFBP2-fibroblast growth factor binding protein 2 Gene
Size: 2ug
Accessions: BC025720
Gene id: 83888
Gene description: fibroblast growth factor binding protein 2
Synonyms: HBP17RP; KSP37; fibroblast growth factor-binding protein 2; 37 kDa killer-specific secretory protein; FGF-BP2; FGF-binding protein 2; FGFBP-2; HBp17-RP; HBp17-related protein; killer-specific secretory protein of 37 kDa; fibroblast growth factor binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagttcgtcccctgcctcctgctggtgaccttgtcctgcctggggactttgggtcaggccccgaggcaaaagcaaggaagcactggggaggaattccatttccagactggagggagagattcctgcactatgcgtcccagcagcttggggcaaggtgctggagaagtctggcttcgcgtcgactgccgcaacacagaccagacctactggtgtgagtacagggggcagcccagcatgtgccaggcttttgctgctgaccccaaaccttactggaatcaagccctgcaggagctgaggcgccttcaccatgcgtgccagggggccccggtgcttaggccatccgtgtgcagggaggctggaccccaggcccatatgcagcaggtgacttccagcctcaagggcagcccagagcccaaccagcagcctgaggctgggacgccatctctgaggcccaaggccacagtgaaactcacagaagcaacacagctgggaaaggactcgatggaagagctgggaaaagccaaacccaccacccgacccacagccaaacctacccagcctggacccaggcccggagggaatgaggaagcaaagaagaaggcctgggaacattgttggaaacccttccaggccctgtgcgcctttctcatcagcttcttccgagggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 3, member D
- nucleolar and spindle associated protein 1
- ubiquitin-conjugating enzyme E2U (putative)
- RAB, member of RAS oncogene family-like 2B

Buy FGFBP2-fibroblast growth factor binding protein 2 Gene now

Add to cart