Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FGFBP2-fibroblast growth factor binding protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FGFBP2-fibroblast growth factor binding protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025720 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FGFBP2 |
| Origin species: | Human |
| Product name: | FGFBP2-fibroblast growth factor binding protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC025720 |
| Gene id: | 83888 |
| Gene description: | fibroblast growth factor binding protein 2 |
| Synonyms: | HBP17RP; KSP37; fibroblast growth factor-binding protein 2; 37 kDa killer-specific secretory protein; FGF-BP2; FGF-binding protein 2; FGFBP-2; HBp17-RP; HBp17-related protein; killer-specific secretory protein of 37 kDa; fibroblast growth factor binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagttcgtcccctgcctcctgctggtgaccttgtcctgcctggggactttgggtcaggccccgaggcaaaagcaaggaagcactggggaggaattccatttccagactggagggagagattcctgcactatgcgtcccagcagcttggggcaaggtgctggagaagtctggcttcgcgtcgactgccgcaacacagaccagacctactggtgtgagtacagggggcagcccagcatgtgccaggcttttgctgctgaccccaaaccttactggaatcaagccctgcaggagctgaggcgccttcaccatgcgtgccagggggccccggtgcttaggccatccgtgtgcagggaggctggaccccaggcccatatgcagcaggtgacttccagcctcaagggcagcccagagcccaaccagcagcctgaggctgggacgccatctctgaggcccaaggccacagtgaaactcacagaagcaacacagctgggaaaggactcgatggaagagctgggaaaagccaaacccaccacccgacccacagccaaacctacccagcctggacccaggcccggagggaatgaggaagcaaagaagaaggcctgggaacattgttggaaacccttccaggccctgtgcgcctttctcatcagcttcttccgagggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 3, member D - nucleolar and spindle associated protein 1 - ubiquitin-conjugating enzyme E2U (putative) - RAB, member of RAS oncogene family-like 2B |