FAM3D-family with sequence similarity 3, member D Gene View larger

FAM3D-family with sequence similarity 3, member D Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM3D-family with sequence similarity 3, member D Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM3D-family with sequence similarity 3, member D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015359
Product type: DNA & cDNA
Ncbi symbol: FAM3D
Origin species: Human
Product name: FAM3D-family with sequence similarity 3, member D Gene
Size: 2ug
Accessions: BC015359
Gene id: 131177
Gene description: family with sequence similarity 3, member D
Synonyms: protein FAM3D; EF7; OIT1; cytokine-like protein EF-7; family with sequence similarity 3 member D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagtgtcaggtgtgcttcgcctcctggccctcatctttgccatagtcacgacatggatgtttattcgaagctacatgagcttcagcatgaaaaccatccgtctgccacgctggctggcagcctcgcccaccaaggagatccaggttaaaaagtacaagtgtggcctcatcaagccctgcccagccaactactttgcgtttaaaatctgcagtggggccgccaacgtcgtgggccctactatgtgctttgaagaccgcatgatcatgagtcctgtgaaaaacaatgtgggcagaggcctaaacatcgccctggtgaatggaaccacgggagctgtgctgggacagaaggcatttgacatgtactctggagatgttatgcacctagtgaaattccttaaagaaattccggggggtgcactggtgctggtggcctcctacgacgatccagggaccaaaatgaacgatgaaagcaggaaactcttctctgacttggggagttcctacgcaaaacaactgggcttccgggacagctgggtcttcataggagccaaagacctcaggggtaaaagcccctttgagcagttcttaaagaacagcccagacacaaacaaatacgagggatggccagagctgctggagatggagggctgcatgcccccgaagccattttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleolar and spindle associated protein 1
- ubiquitin-conjugating enzyme E2U (putative)
- RAB, member of RAS oncogene family-like 2B
- family with sequence similarity 3, member A

Buy FAM3D-family with sequence similarity 3, member D Gene now

Add to cart