Login to display prices
Login to display prices
FAM3D-family with sequence similarity 3, member D Gene View larger

FAM3D-family with sequence similarity 3, member D Gene

PTXBC015359

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM3D-family with sequence similarity 3, member D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM3D-family with sequence similarity 3, member D Gene

Proteogenix catalog: PTXBC015359
Ncbi symbol: FAM3D
Product name: FAM3D-family with sequence similarity 3, member D Gene
Size: 2ug
Accessions: BC015359
Gene id: 131177
Gene description: family with sequence similarity 3, member D
Synonyms: protein FAM3D; EF7; OIT1; cytokine-like protein EF-7; family with sequence similarity 3 member D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagtgtcaggtgtgcttcgcctcctggccctcatctttgccatagtcacgacatggatgtttattcgaagctacatgagcttcagcatgaaaaccatccgtctgccacgctggctggcagcctcgcccaccaaggagatccaggttaaaaagtacaagtgtggcctcatcaagccctgcccagccaactactttgcgtttaaaatctgcagtggggccgccaacgtcgtgggccctactatgtgctttgaagaccgcatgatcatgagtcctgtgaaaaacaatgtgggcagaggcctaaacatcgccctggtgaatggaaccacgggagctgtgctgggacagaaggcatttgacatgtactctggagatgttatgcacctagtgaaattccttaaagaaattccggggggtgcactggtgctggtggcctcctacgacgatccagggaccaaaatgaacgatgaaagcaggaaactcttctctgacttggggagttcctacgcaaaacaactgggcttccgggacagctgggtcttcataggagccaaagacctcaggggtaaaagcccctttgagcagttcttaaagaacagcccagacacaaacaaatacgagggatggccagagctgctggagatggagggctgcatgcccccgaagccattttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: