FAM3A-family with sequence similarity 3, member A Gene View larger

FAM3A-family with sequence similarity 3, member A Gene

PTXBC008912

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM3A-family with sequence similarity 3, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM3A-family with sequence similarity 3, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008912
Product type: DNA & cDNA
Ncbi symbol: FAM3A
Origin species: Human
Product name: FAM3A-family with sequence similarity 3, member A Gene
Size: 2ug
Accessions: BC008912
Gene id: 60343
Gene description: family with sequence similarity 3, member A
Synonyms: protein FAM3A; DLD; DXS560S; XAP-7; cytokine-like protein 2-19; family with sequence similarity 3 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggttggcaggccctctccgcattgtggtcctagtcgtcagtgtgggtgtcacatggatcgtggtcagcatcctcctgggtgggcctggcagtggctttcctcgcatccagcaactcttcaccagtccagagagctcggtgactgcagcgccacgggccaggaagtacaagtgtggcctgccccagccgtgtcctgaggagcacctggccttccgcgtggtcagcggggccgccaacgtcattgggcccaagatctgcctcgaggacaagatgctgatgagcagcgtcaaggacaacgtgggccgcgggctgaacatcgccctggtgaacggggtcagcggcgagctcatcgaggcccgggcctttgacatgtgggccggagatgtcaacgacctgttgaagtttattcggccactgcacgaaggcaccctggtgttcgtggcatcctacgacgacccagccaccaagatgaatgaagagaccagaaagctcttcagtgagctgggcagcaggaacgccaaggagctggccttccgggacagctgggtgtttgtcggggccaagggtgtgcagaacaagagcccctttgagcagcacgtgaagaacagtaagcacagcaacaagtacgaaggctggcccgaggcgctggagatggaaggctgtatcccgcggagaagcacggccagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine peptidase inhibitor, Kunitz type, 2
- glutamate-cysteine ligase, catalytic subunit
- metallophosphoesterase domain containing 2
- DNA (cytosine-5-)-methyltransferase 3-like

Buy FAM3A-family with sequence similarity 3, member A Gene now

Add to cart