Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GCLC-glutamate-cysteine ligase, catalytic subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GCLC-glutamate-cysteine ligase, catalytic subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022487 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GCLC |
| Origin species: | Human |
| Product name: | GCLC-glutamate-cysteine ligase, catalytic subunit Gene |
| Size: | 2ug |
| Accessions: | BC022487 |
| Gene id: | 2729 |
| Gene description: | glutamate-cysteine ligase, catalytic subunit |
| Synonyms: | GCL; GCS; GLCL; GLCLC; glutamate--cysteine ligase catalytic subunit; GCS heavy chain; gamma-ECS; gamma-glutamylcysteine synthetase; glutamate-cysteine ligase catalytic subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggctgctgtcccagggctcgccgctgagctgggaggaaaccaagcgccatgccgaccacgtgcggcggcacgggatcctccagttcctgcacatctaccacgccgtcaaggaccggcacaaggacgttctcaagtggggcgatgaggtggaatacatgttggtatcttttgatcatgaaaataaaaaagtccggttggtcctgtctggggagaaagttcttgaaactctgcaagagaagggggaaaggacaaacccaaaccatcctaccctttggagaccagagtatgggagttacatgattgaagggacaccaggacagccctacggaggaacaatgtccgagttcaatacagttgaggccaacatgcgaaaacgccggaaggaggctacttctatattagaagaaaatcaggctctttgcacaataacttcatttcccagattaggctgtcctgggttcacactgcccgaggtcaaacccaacccagtggaaggaggagcttccaagtccctcttctttccagatgaagcaataaacaagcaccctcgcttcagtaccttaacaagaaatatccgacataggagaggagaaaaggttgtcatcaatgtaccaatatttaaggacaagaatacaccatctccatttatagaaacatttactgaggatgatgaagcttcaagggcttctaagccggatcatatttacatggatgccatgggatttggaatgggcaattgctgtctccaggtatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - metallophosphoesterase domain containing 2 - DNA (cytosine-5-)-methyltransferase 3-like - nucleolar and spindle associated protein 1 - calcium binding and coiled-coil domain 2 |