Login to display prices
Login to display prices
GCLC-glutamate-cysteine ligase, catalytic subunit Gene View larger

GCLC-glutamate-cysteine ligase, catalytic subunit Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GCLC-glutamate-cysteine ligase, catalytic subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GCLC-glutamate-cysteine ligase, catalytic subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022487
Product type: DNA & cDNA
Ncbi symbol: GCLC
Origin species: Human
Product name: GCLC-glutamate-cysteine ligase, catalytic subunit Gene
Size: 2ug
Accessions: BC022487
Gene id: 2729
Gene description: glutamate-cysteine ligase, catalytic subunit
Synonyms: GCL; GCS; GLCL; GLCLC; glutamate--cysteine ligase catalytic subunit; GCS heavy chain; gamma-ECS; gamma-glutamylcysteine synthetase; glutamate-cysteine ligase catalytic subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctgctgtcccagggctcgccgctgagctgggaggaaaccaagcgccatgccgaccacgtgcggcggcacgggatcctccagttcctgcacatctaccacgccgtcaaggaccggcacaaggacgttctcaagtggggcgatgaggtggaatacatgttggtatcttttgatcatgaaaataaaaaagtccggttggtcctgtctggggagaaagttcttgaaactctgcaagagaagggggaaaggacaaacccaaaccatcctaccctttggagaccagagtatgggagttacatgattgaagggacaccaggacagccctacggaggaacaatgtccgagttcaatacagttgaggccaacatgcgaaaacgccggaaggaggctacttctatattagaagaaaatcaggctctttgcacaataacttcatttcccagattaggctgtcctgggttcacactgcccgaggtcaaacccaacccagtggaaggaggagcttccaagtccctcttctttccagatgaagcaataaacaagcaccctcgcttcagtaccttaacaagaaatatccgacataggagaggagaaaaggttgtcatcaatgtaccaatatttaaggacaagaatacaccatctccatttatagaaacatttactgaggatgatgaagcttcaagggcttctaagccggatcatatttacatggatgccatgggatttggaatgggcaattgctgtctccaggtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - metallophosphoesterase domain containing 2
- DNA (cytosine-5-)-methyltransferase 3-like
- nucleolar and spindle associated protein 1
- calcium binding and coiled-coil domain 2