MPPED2-metallophosphoesterase domain containing 2 Gene View larger

MPPED2-metallophosphoesterase domain containing 2 Gene

PTXBC031582

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPPED2-metallophosphoesterase domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MPPED2-metallophosphoesterase domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031582
Product type: DNA & cDNA
Ncbi symbol: MPPED2
Origin species: Human
Product name: MPPED2-metallophosphoesterase domain containing 2 Gene
Size: 2ug
Accessions: BC031582
Gene id: 744
Gene description: metallophosphoesterase domain containing 2
Synonyms: metallophosphoesterase MPPED2; 239FB; C11orf8; fetal brain protein 239; metallophosphoesterase domain-containing protein 2; metallophosphoesterase domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacatgggattccttctcaaggcaaagttaccataacggtggatgagtacagctcaaaccccacccaggcattcacgcactacaacatcaaccagagcagattccagcctccacatgtacatatggtcgaccccatcccatatgacactccaaaaccagcgggccacacgcggtttgtctgcatctcagacacacactccagaacagatggtatccagatgccttatggggacatccttctccacacaggcgatttcaccgagctgggactgccctcagaggttaagaagtttaatgactggttaggaaacctgccatatgaatataaaatagtgattgctgggaatcatgaactgacatttgataaggaattcatggcagaccttgttaaacaggactactaccgtttcccctctgtgtccaaattgaaaccagaggactttgacaatgttcagtccctcctgacaaacagtatttacttacaagattcggaggtaacagtgaagggattcaggatatacggtgcaccttggaccccgtggtttaatggatggggctttaacctacccagaggtcagtctctgctggacaagtggaacctcatccctgagggcattgacatactcatgacacatggacctcctctaggttttcgagactgggttccaaaggagcttcaaagagtgggctgtgtggagctgttaaacacggttcagaggcgagtccggcccaagctccatgtgtttggtggaatccatgaaggttatggcatcatgaccgacggttacacaacgtacatcaatgcctcgacgtgtacagtcagctttcaaccgaccaaccctccaattatatttgaccttccaaacccacagggttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DNA (cytosine-5-)-methyltransferase 3-like
- nucleolar and spindle associated protein 1
- calcium binding and coiled-coil domain 2
- GC-rich promoter binding protein 1-like 1

Buy MPPED2-metallophosphoesterase domain containing 2 Gene now

Add to cart