Login to display prices
Login to display prices
MPPED2-metallophosphoesterase domain containing 2 Gene View larger

MPPED2-metallophosphoesterase domain containing 2 Gene

PTXBC031582

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPPED2-metallophosphoesterase domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MPPED2-metallophosphoesterase domain containing 2 Gene

Proteogenix catalog: PTXBC031582
Ncbi symbol: MPPED2
Product name: MPPED2-metallophosphoesterase domain containing 2 Gene
Size: 2ug
Accessions: BC031582
Gene id: 744
Gene description: metallophosphoesterase domain containing 2
Synonyms: metallophosphoesterase MPPED2; 239FB; C11orf8; fetal brain protein 239; metallophosphoesterase domain-containing protein 2; metallophosphoesterase domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacatgggattccttctcaaggcaaagttaccataacggtggatgagtacagctcaaaccccacccaggcattcacgcactacaacatcaaccagagcagattccagcctccacatgtacatatggtcgaccccatcccatatgacactccaaaaccagcgggccacacgcggtttgtctgcatctcagacacacactccagaacagatggtatccagatgccttatggggacatccttctccacacaggcgatttcaccgagctgggactgccctcagaggttaagaagtttaatgactggttaggaaacctgccatatgaatataaaatagtgattgctgggaatcatgaactgacatttgataaggaattcatggcagaccttgttaaacaggactactaccgtttcccctctgtgtccaaattgaaaccagaggactttgacaatgttcagtccctcctgacaaacagtatttacttacaagattcggaggtaacagtgaagggattcaggatatacggtgcaccttggaccccgtggtttaatggatggggctttaacctacccagaggtcagtctctgctggacaagtggaacctcatccctgagggcattgacatactcatgacacatggacctcctctaggttttcgagactgggttccaaaggagcttcaaagagtgggctgtgtggagctgttaaacacggttcagaggcgagtccggcccaagctccatgtgtttggtggaatccatgaaggttatggcatcatgaccgacggttacacaacgtacatcaatgcctcgacgtgtacagtcagctttcaaccgaccaaccctccaattatatttgaccttccaaacccacagggttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: