Login to display prices
Login to display prices
DNMT3L-DNA (cytosine-5-)-methyltransferase 3-like Gene View larger

DNMT3L-DNA (cytosine-5-)-methyltransferase 3-like Gene

PTXBC002560

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNMT3L-DNA (cytosine-5-)-methyltransferase 3-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNMT3L-DNA (cytosine-5-)-methyltransferase 3-like Gene

Proteogenix catalog: PTXBC002560
Ncbi symbol: DNMT3L
Product name: DNMT3L-DNA (cytosine-5-)-methyltransferase 3-like Gene
Size: 2ug
Accessions: BC002560
Gene id: 29947
Gene description: DNA (cytosine-5-)-methyltransferase 3-like
Synonyms: DNA (cytosine-5)-methyltransferase 3-like; DNA (cytosine-5-)-methyltransferase 3-like; cytosine-5-methyltransferase 3-like protein; human cytosine-5-methyltransferase 3-like protein; DNA methyltransferase 3 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccatcccagccctggacccagaggccgagcccagcatggacgtgattttggtgggatccagtgagctctcaagctccgtttcacccgggacaggcagagatcttattgcatatgaagtcaaggctaaccagcgaaatatagaagacatctgcatctgctgcggaagtctccaggttcacacacagcaccctctgtttgagggagggatctgcgccccatgtaaggacaagttcctggatgccctcttcctgtacgacgatgacgggtaccaatcctactgctccatctgctgctccggagagacgctgctcatctgcggaaaccctgattgcacccgatgctactgcttcgagtgtgtggatagcctggtcggccccgggacctcggggaaggtgcacgccatgagcaactgggtgtgctacctgtgcctgccgtcctcccgaagcgggctgctgcagcgtcggaggaagtggcgcagccagctcaaggccttctacgaccgagagtcggagaatccccttgagatgttcgaaaccgtgcctgtgtggaggagacagccagtccgggtgctgtccctttttgaagacatcaagaaagagctgacgagtttgggctttttggaaagtggttctgacccgggacaactgaagcatgtggttgatgtcacagacacagtgaggaaggatgtggaggagtggggacccttcgatcttgtgtacggcgccacacctcccctgggccacacctgtgaccgtcctcccagctggtacctgttccagttccaccggctcctgcagtacgcacggcccaagccaggcagccccgggcccttcttctggatgttcgtggacaatctggtgctgaacaaggaagacctggacgtcgcatctcgcttcctggagatggagccagtcaccatcccagatgtccacggcggatccttgcagaatgctgtccgcgtgtggagcaacatcccagccataaggagcaggcactgggctctggtttcggaagaagaattgtccctgctggcccagaacaagcagagctcgaagctcgcggccaagtggcccaccaagctggtgaagaactgctttctccccctaagagaatatttcaagtatttttcaacagaactcacttcctctttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: