No products
Prices are tax excluded
PTXBC010838
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010838 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUSAP1 |
| Origin species: | Human |
| Product name: | NUSAP1-nucleolar and spindle associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC010838 |
| Gene id: | 51203 |
| Gene description: | nucleolar and spindle associated protein 1 |
| Synonyms: | ANKT; BM037; LNP; NUSAP; PRO0310p1; Q0310; SAPL; nucleolar and spindle-associated protein 1; nucleolar protein ANKT; nucleolar and spindle associated protein 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgaactgaagcagcccatcaataagggaggggtcaggactccagtacctccaagaggaagactctctgtggcttctactcccatcagccaacgacgctcgcaaggccggtcttgtggccctgcaagtcagagtaccttgggtctgaaggggtcactcaagcgctctgctatctctgcagctaaaacgggtgtcaggttttcagctgctactaaagataatgagcataagcgttcactgaccaagactccagccagaaagtctgcacatgtgaccgtgtctgggggcaccccaaaaggcgaggctgtgcttgggacacacaaattaaagaccatcacggggaattctgctgctgttattaccccattcaagttgacaactgaggcaacgcagactccagtctccaataagaaaccagtgtttgatcttaaagcaagtttgtctcgtcccctcaactatgaaccacacaaaggaaagctaaaaccatgggggcaatctaaagaaaataattatctaaatcaacatgtcaacagaattaacttctacaagaaaacttacaaacaaccccatctccagacaaaggaagagcaacggaagaaacgcgagcaagaacgaaaggagaagaaagcaaaggttttgggaatgcgaaggggcctcattttggctgaagattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2U (putative) - RAB, member of RAS oncogene family-like 2B - family with sequence similarity 3, member A - serine peptidase inhibitor, Kunitz type, 2 |