Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OLR1-oxidized low density lipoprotein (lectin-like) receptor 1 Gene
PTXBC022295
New product
Data sheet of OLR1-oxidized low density lipoprotein (lectin-like) receptor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OLR1-oxidized low density lipoprotein (lectin-like) receptor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022295 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OLR1 |
| Origin species: | Human |
| Product name: | OLR1-oxidized low density lipoprotein (lectin-like) receptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC022295 |
| Gene id: | 4973 |
| Gene description: | oxidized low density lipoprotein (lectin-like) receptor 1 |
| Synonyms: | CLEC8A; LOX1; LOXIN; SCARE1; SLOX1; oxidized low-density lipoprotein receptor 1; C-type lectin domain family 8 member A; hLOX-1; lectin-type oxidized LDL receptor 1; ox LDL receptor 1; oxidized low density lipoprotein (lectin-like) receptor 1; oxidized low-density lipoprotein receptor 1, soluble form; scavenger receptor class E, member 1; oxidized low density lipoprotein receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacttttgatgacctaaagatccagactgtgaaggaccagcctgatgagaagtcaaatggaaaaaaagctaaaggtcttcagtttctttactctccatggtggtgcctggctgctgcgactctaggggtcctttgcctgggattagtagtgaccattatggtgctgggcatgcaattatcccaggtgtctgacctcctaacacaagagcaagcaaacctaactcaccagaaaaagaaactggagggacagatctcagcccggcaacaagcagaagaagcttcacaggagtcagaaaacgaactcaaggaaatgatagaaacccttgctcggaagctgaatgagaaatccaaagagcaaatggaacttcaccaccagaatctgaatctccaagaaacactgaagagagtagcaaattgttcagctccttgtccgcaagactggatctggcatggagaaaactgttacctattttcctcgggctcatttaactgggaaaagagccaagagaagtgcttgtctttggatgccaagttgctgaaaattaatagcacagctgatctggacttcatccagcaagcaatttcctattccagttttccattctggatggggctgtctcggaggaaccccagctacccatggctctgggaggacggttctcctttgatgccccacttatttagagtccgaggcgctgtctcccagacatacccttcaggtacctgtgcatatatacaacgaggagctgtttatgcggaaaactgcattttagctgccttcagtatatgtcagaagaaggcaaacctaagagcacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) - RNA (guanine-9-) methyltransferase domain containing 1 - phosphoinositide-3-kinase, regulatory subunit 1 (alpha) - cytochrome P450, family 20, subfamily A, polypeptide 1 |