Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNGT1-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 Gene
PTXBC029367
New product
Data sheet of GNGT1-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNGT1-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029367 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNGT1 |
| Origin species: | Human |
| Product name: | GNGT1-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC029367 |
| Gene id: | 2792 |
| Gene description: | guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 |
| Synonyms: | GNG1; guanine nucleotide-binding protein G(T) subunit gamma-T1; guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1; transducin gamma chain; G protein subunit gamma transducin 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagtaatcaatattgaggacctgacagaaaaggacaaattgaagatggaagttgaccagctcaagaaagaagtgacactggaaagaatgctagtttccaaatgttgtgaagaagtaagagattacgttgaagaacgatctggcgaggatccactggtaaagggcatcccagaggacaaaaatcccttcaaggagctcaaaggaggctgtgtgatttcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B - DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) - integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) - guanine nucleotide binding protein (G protein), alpha 11 (Gq class) |