Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MGAT5B-mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B Gene
PTXBC063862
New product
Data sheet of MGAT5B-mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGAT5B-mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063862 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGAT5B |
| Origin species: | Human |
| Product name: | MGAT5B-mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B Gene |
| Size: | 2ug |
| Accessions: | BC063862 |
| Gene id: | 146664 |
| Gene description: | mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B |
| Synonyms: | GnT-IX; GnT-VB; alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase B; N-acetylglucosaminyl-transferase Vb; N-acetylglucosaminyltransferase IX; alpha-mannoside beta-1,6-N-acetylglucosaminyltransferase B; beta(1,6)-N-acetylglucosaminyltransferase V; glcNAc-T Vb; hGnTVb; mannoside acetylglucosaminyltransferase 5B; mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B; mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagggcccccgacggctgggccttctcccgccccatgtgtctgcccatccctcccacaggtagacccctacctaccctacgagtacacctgcgaggggatgctggagcggatccacgcctacatccagcaccaggacttctgcagagctccagaccctgccctaccagaggcccacgccccgcagagcccctttgtcctggcccccaatgccacccacctcgagtgggctcggaacaccagcttggctcctggggcctggccccccgcgcacgccctgcgggcctggctggccgtgcctgggagggcctgcaccgacacctgcctggaccacgggctaatctgtgagccctccttcttccccttcctgaacagccaggacgccttcctcaagctgcaggtgccctgtgacagcaccgagtcggagatgaaccacctgtacccggcgttcgcccagcctggccaggagtgctacctgcagaaggagcctctgctcttcagctgcgccggctccaacaccaagtaccgccggctctgcccctgccgcgacttccgcaagggccaggtggccttgtgccagggctgtctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) - integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) - guanine nucleotide binding protein (G protein), alpha 11 (Gq class) - protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta |