Login to display prices
Login to display prices
GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene View larger

GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001528
Product type: DNA & cDNA
Ncbi symbol: GNA11
Origin species: Human
Product name: GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene
Size: 2ug
Accessions: BC001528
Gene id: 2767
Gene description: guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
Synonyms: FBH; FBH2; FHH2; GNA-11; HHC2; HYPOC2; guanine nucleotide-binding protein subunit alpha-11; g alpha-11; guanine nucleotide binding protein (G protein), alpha 11 (Gq class); guanine nucleotide-binding protein G(y) subunit alpha; G protein subunit alpha 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcgcctgtgctgccttcgcccgccgccacaccgggaccctgcacggctgcttctggcctcgacagatgacaaaagaaacagccccaaaatacgaccactccaaccagcagttcccgcctgcctgcccgccactgtcaggcctgccctggcctcctcgtccgcagggctgtctgctggcttctgggggcagaagagcggggagccccgtggaagggtcaggggagaccaggtcagggcagctacatttctggtgatcagccccatggggagacggggctggcgggataccgcccccccggcttccccacaccacttctgtctcacccggaagcgtcctttttttgtgccaggtgtctacctaagagggttggtgccagaagccccccatggcgagtgctggggcccggcggtgccctgggggagcagatggggccacccctggcagggccgctacaactttttccagcagcggagccctctggggggcctgtgcttgtggcatctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta
- guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
- single immunoglobulin and toll-interleukin 1 receptor (TIR) domain