Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene
PTXBC001528
New product
Data sheet of GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001528 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNA11 |
| Origin species: | Human |
| Product name: | GNA11-guanine nucleotide binding protein (G protein), alpha 11 (Gq class) Gene |
| Size: | 2ug |
| Accessions: | BC001528 |
| Gene id: | 2767 |
| Gene description: | guanine nucleotide binding protein (G protein), alpha 11 (Gq class) |
| Synonyms: | FBH; FBH2; FHH2; GNA-11; HHC2; HYPOC2; guanine nucleotide-binding protein subunit alpha-11; g alpha-11; guanine nucleotide binding protein (G protein), alpha 11 (Gq class); guanine nucleotide-binding protein G(y) subunit alpha; G protein subunit alpha 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcgcctgtgctgccttcgcccgccgccacaccgggaccctgcacggctgcttctggcctcgacagatgacaaaagaaacagccccaaaatacgaccactccaaccagcagttcccgcctgcctgcccgccactgtcaggcctgccctggcctcctcgtccgcagggctgtctgctggcttctgggggcagaagagcggggagccccgtggaagggtcaggggagaccaggtcagggcagctacatttctggtgatcagccccatggggagacggggctggcgggataccgcccccccggcttccccacaccacttctgtctcacccggaagcgtcctttttttgtgccaggtgtctacctaagagggttggtgccagaagccccccatggcgagtgctggggcccggcggtgccctgggggagcagatggggccacccctggcagggccgctacaactttttccagcagcggagccctctggggggcctgtgcttgtggcatctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta - guanine nucleotide binding protein (G protein), alpha 15 (Gq class) - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 - single immunoglobulin and toll-interleukin 1 receptor (TIR) domain |