Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene
PTXBC003591
New product
Data sheet of SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003591 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SIGIRR |
| Origin species: | Human |
| Product name: | SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene |
| Size: | 2ug |
| Accessions: | BC003591 |
| Gene id: | 59307 |
| Gene description: | single immunoglobulin and toll-interleukin 1 receptor (TIR) domain |
| Synonyms: | IL-1R8; TIR8; single Ig IL-1-related receptor; single Ig IL-1R-related molecule; single immunoglobulin and toll-interleukin 1 receptor (TIR) domain; single immunoglobulin domain IL1R1 related; single immunoglobulin domain-containing IL1R-related protein; toll/interleukin-1 receptor 8; single Ig and TIR domain containing |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaggtgtctgtgatagggcccctgacttcctctccccgtctgaagaccaggtgctgaggcctgccttgggcagctcagtggctctgaactgcacggcttgggtagtctctgggccccactgctccctgccttcagtccagtggctgaaagacgggcttccattgggaattgggggccactacagcctccacgagtactcctgggtcaaggccaacctgtcagaggtgcttgtgtccagtgtcctgggggtcaacgtgaccagcactgaagtctatggggccttcacctgctccatccagaacatcagcttctcctccttcactcttcagagagctggccctacaagccacgtggctgcggtgctggcctccctcctggtcctgctggccctgctgctggccgccctgctctatgtcaagtgccgtctcaacgtgctgctctggtaccaggacgcgtatggggaggtggagataaacgacgggaagctctacgacgcctacgtctcctacagcgactgccccgaggaccgcaagttcgtgaacttcatcctaaagccgcagctggagcggcgtcggggctacaagctcttcctggacgaccgcgacctcctgccgcgcgctgagccctccgccgacctcttggtgaacctgagccgctgccgacgcctcatcgtggtgctttcggacgccttcctgagccgggcctggtgcagccacagcttccgggagggcctgtgccggctgctggagctcacccgcagacccatcttcatcaccttcgagggccagaggcgcgaccccgcgcacccggcgctccgcctgctgcgccagcaccgccacctggtgaccttgctgctctggaggcccggctccgtgactccttcctccgatttttggaaagaagtgcagctggcgctgccgcggaaggtgcggtacaggccggtggaaggagacccccagacgcagctgcaggacgacaaggaccccatgctgattcttcgaggccgagtccctgagggccgggccctggactcagaggtggacccggaccctgagggcgacctgggtgtccgggggcctgtttttggagagccatcagctccaccgcacaccagtggggtctcgctgggagagagccggagcagcgaagtggacgtctcggatctcggctcgcgaaactacagtgcccgcacagacttctactgcctggtgtccaaggatgatatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa - leucine-rich repeats and calponin homology (CH) domain containing 4 - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 |