Login to display prices
Login to display prices
SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene View larger

SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003591
Product type: DNA & cDNA
Ncbi symbol: SIGIRR
Origin species: Human
Product name: SIGIRR-single immunoglobulin and toll-interleukin 1 receptor (TIR) domain Gene
Size: 2ug
Accessions: BC003591
Gene id: 59307
Gene description: single immunoglobulin and toll-interleukin 1 receptor (TIR) domain
Synonyms: IL-1R8; TIR8; single Ig IL-1-related receptor; single Ig IL-1R-related molecule; single immunoglobulin and toll-interleukin 1 receptor (TIR) domain; single immunoglobulin domain IL1R1 related; single immunoglobulin domain-containing IL1R-related protein; toll/interleukin-1 receptor 8; single Ig and TIR domain containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaggtgtctgtgatagggcccctgacttcctctccccgtctgaagaccaggtgctgaggcctgccttgggcagctcagtggctctgaactgcacggcttgggtagtctctgggccccactgctccctgccttcagtccagtggctgaaagacgggcttccattgggaattgggggccactacagcctccacgagtactcctgggtcaaggccaacctgtcagaggtgcttgtgtccagtgtcctgggggtcaacgtgaccagcactgaagtctatggggccttcacctgctccatccagaacatcagcttctcctccttcactcttcagagagctggccctacaagccacgtggctgcggtgctggcctccctcctggtcctgctggccctgctgctggccgccctgctctatgtcaagtgccgtctcaacgtgctgctctggtaccaggacgcgtatggggaggtggagataaacgacgggaagctctacgacgcctacgtctcctacagcgactgccccgaggaccgcaagttcgtgaacttcatcctaaagccgcagctggagcggcgtcggggctacaagctcttcctggacgaccgcgacctcctgccgcgcgctgagccctccgccgacctcttggtgaacctgagccgctgccgacgcctcatcgtggtgctttcggacgccttcctgagccgggcctggtgcagccacagcttccgggagggcctgtgccggctgctggagctcacccgcagacccatcttcatcaccttcgagggccagaggcgcgaccccgcgcacccggcgctccgcctgctgcgccagcaccgccacctggtgaccttgctgctctggaggcccggctccgtgactccttcctccgatttttggaaagaagtgcagctggcgctgccgcggaaggtgcggtacaggccggtggaaggagacccccagacgcagctgcaggacgacaaggaccccatgctgattcttcgaggccgagtccctgagggccgggccctggactcagaggtggacccggaccctgagggcgacctgggtgtccgggggcctgtttttggagagccatcagctccaccgcacaccagtggggtctcgctgggagagagccggagcagcgaagtggacgtctcggatctcggctcgcgaaactacagtgcccgcacagacttctactgcctggtgtccaaggatgatatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
- leucine-rich repeats and calponin homology (CH) domain containing 4
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2