Login to display prices
Login to display prices
ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene View larger

ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001178
Product type: DNA & cDNA
Ncbi symbol: ATP5J
Origin species: Human
Product name: ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene
Size: 2ug
Accessions: BC001178
Gene id: 522
Gene description: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6
Synonyms: ATP5; ATP5A; ATPM; CF6; ATP synthase-coupling factor 6, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6; ATPase subunit F6; coupling factor 6; mitochondrial ATP synthase, coupling factor 6; mitochondrial ATP synthase, subunit F6; mitochondrial ATPase coupling factor 6; proliferation-inducing protein 36; ATP synthase, H+ transporting, mitochondrial Fo complex subunit F6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
- collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
- leucine-rich repeats and calponin homology (CH) domain containing 3
- erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)