Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene
PTXBC001178
New product
Data sheet of ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001178 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5J |
| Origin species: | Human |
| Product name: | ATP5J-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 Gene |
| Size: | 2ug |
| Accessions: | BC001178 |
| Gene id: | 522 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 |
| Synonyms: | ATP5; ATP5A; ATPM; CF6; ATP synthase-coupling factor 6, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6; ATPase subunit F6; coupling factor 6; mitochondrial ATP synthase, coupling factor 6; mitochondrial ATP synthase, subunit F6; mitochondrial ATPase coupling factor 6; proliferation-inducing protein 36; ATP synthase, H+ transporting, mitochondrial Fo complex subunit F6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 - collagen, type IV, alpha 3 (Goodpasture antigen) binding protein - leucine-rich repeats and calponin homology (CH) domain containing 3 - erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) |