B4GALT2-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 Gene View larger

B4GALT2-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of B4GALT2-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about B4GALT2-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002431
Product type: DNA & cDNA
Ncbi symbol: B4GALT2
Origin species: Human
Product name: B4GALT2-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 Gene
Size: 2ug
Accessions: BC002431
Gene id: 8704
Gene description: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Synonyms: B4Gal-T2; B4Gal-T3; beta4Gal-T2; beta-1,4-galactosyltransferase 2; UDP-Gal:beta-GlcNAc beta-1,4-galactosyltransferase 2; UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase 2; UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 2; UDP-galactose:beta-N-acetylglucosamine beta-1,4-galactosyltransferase 2; beta-1,4-GalTase 2; beta-4-GalT2; beta-N-acetylglucosaminyl-glycolipid beta-1,4-galactosyltransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccctccacccagctgctagcagcagcagcagcagcagcaactgctcccggcccaacgccaccgcctctagctccgggctccctgaggtccccagtgccctgcccggtcccacggctcccacgctgccaccctgtcctgactcgccacctggtcttgcgggtgcacagggagaacccaggcgtgctcatgggcggccgatacacaccgcccgactgcaccccagcccagacggtggcggtcatcatcccctttagacaccgggaacaccacctgcgctactggctccactatctacaccccatcttgaggcggcagcggctgcgctacggcgtctatgtcatcaaccagcatggtgaggacaccttcaaccgggccaagctgcttaacgtgggcttcctagaggcgctgaaggaggatgccgcctatgactgcttcatcttcagcgatgtggacctggtccccatggatgaccgcaacctataccgctgcggcgaccaaccccgccactttgccattgccatggacaagtttggcttccggcttccctatgctggctactttggaggtgtgtcaggcctgagtaaggctcagtttctgagaatcaatggcttccccaatgagtactggggctggggtggcgaggatgatgacatcttcaaccggatctccctgactgggatgaagatctcacgcccagacatccgaattggccgctaccgcatgatcaagcacgaccgcgacaagcataacgaacctaaccctcagaggtttaccaagattcaaaacacgaagctgaccatgaagcgggacggcattgggtcagtgcggtaccaggtcttggaggtgtctcggcaaccactcttcaccaatatcacagtggacattgggcggcctccgtcgtggccccctcggggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
- leucine-rich repeats and calponin homology (CH) domain containing 3
- erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
- protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta

Buy B4GALT2-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 Gene now

Add to cart