COL4A3BP-collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene View larger

COL4A3BP-collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene


New product

Data sheet of COL4A3BP-collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COL4A3BP-collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000102
Product type: DNA & cDNA
Ncbi symbol: COL4A3BP
Origin species: Human
Product name: COL4A3BP-collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene
Size: 2ug
Accessions: BC000102
Gene id: 10087
Gene description: collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Synonyms: CERT; CERTL; GPBP; MRD34; STARD11; collagen type IV alpha-3-binding protein; StAR-related lipid transfer (START) domain containing 11; ceramide transfer protein; ceramide transporter; collagen, type IV, alpha 3 (Goodpasture antigen) binding protein; hCERT; lipid-transfer protein CERTL; collagen type IV alpha 3 binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggataatcagagctggaactcgtcgggctcggaggaggatccagagacggagtctgggccgcctgtggagcgctgcggggtcctcagtaagtggacaaactacattcatgggtggcaggatcgttgggtagttttgaaaaataatgctctgagttactacaaatctgaagatgaaacagagtatggctgcagaggatccatctgtcttagcaaggctgtcatcacacctcacgattttgatgaatgtcgatttgatattagtgtaaatgatagtgtttggtatcttcgtgctcaggatccagatcatagacagcaatggatagatgccattgaacagcacaagactgaatctggatatggatctgaatccagcttgcgtcgacatggctcaatggtgtccctggtgtctggagcaagtggctactctgcaacatccacctcttcattcaagaaaggccacagtttacgtgagaagttggctgaaatggaaacatttagagacatcttatgtagacaagttgacacgctacagaagtactttgatgcctgtgctgatgctgtctctaaggatgaacttcaaagggataaagtggtagaagatgatgaagatgactttcctacaacgcgttctgatggtgacttcttgcatagtaccaacggcaataaagaaaagttatttccacatgtgacaccaaaaggaattaatggtatagactttaaaggggaagcgataacttttaaagcaactactgctggaatccttgcaacactttctcattgtattgaactaatggttaaacgtgaggacagctggcagaagagactggataaggaaactgagaagaaaagaagaacagaggaagcatataaaaatgcaatgacagaacttaagaaaaaatcccactttggaggaccagattatgaagaaggccctaacagtctgattaatgaagaagagttctttgatgctgttgaagctgctcttgacagacaagataaaatagaagaacagtcacagagtgaaaaggtgagattacattggcctacatccttgccctctggagatgccttttcttctgtggggacacatagatttgtccaaaaggttgaagagatggtgcagaaccacatgacttactcattacaggatgtaggcggagatgccaattggcagttggttgtagaagaaggagaaatgaaggtatacagaagagaagtagaagaaaatgggattgttctggatcctttaaaagctacccatgcagttaaaggcgtcacaggacatgaagtctgcaattatttctggaatgttgacgttcgcaatgactgggaaacaactatagaaaactttcatgtggtggaaacattagctgataatgcaatcatcatttatcaaacacacaagagggtgtggcctgcttctcagcgagacgtattatatctttctgtcattcgaaagataccagccttgactgaaaatgaccctgaaacttggatagtttgtaatttttctgtggatcatgacagtgctcctctaaacaaccgatgtgtccgtgccaaaataaatgttgctatgatttgtcaaaccttggtaagcccaccagagggaaaccaggaaattagcagggacaacattctatgcaagattacatatgtagctaatgtgaaccctggaggatgggcaccagcctcagtgttaagggcagtggcaaagcgagagtatcctaaatttctaaaacgttttacttcttacgtccaagaaaaaactgcaggaaagcctattttgttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine-rich repeats and calponin homology (CH) domain containing 3
- erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
- protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta
- toll-interleukin 1 receptor (TIR) domain containing adaptor protein

Buy COL4A3BP-collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene now

Add to cart