TIRAP-toll-interleukin 1 receptor (TIR) domain containing adaptor protein Gene View larger

TIRAP-toll-interleukin 1 receptor (TIR) domain containing adaptor protein Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIRAP-toll-interleukin 1 receptor (TIR) domain containing adaptor protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TIRAP-toll-interleukin 1 receptor (TIR) domain containing adaptor protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032474
Product type: DNA & cDNA
Ncbi symbol: TIRAP
Origin species: Human
Product name: TIRAP-toll-interleukin 1 receptor (TIR) domain containing adaptor protein Gene
Size: 2ug
Accessions: BC032474
Gene id: 114609
Gene description: toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Synonyms: BACTS1; Mal; MyD88-2; wyatt; toll/interleukin-1 receptor domain-containing adapter protein; MyD88 adapter-like protein; Toll-like receptor adaptor protein; adapter protein wyatt; adaptor protein Wyatt; toll-interleukin 1 receptor (TIR) domain containing adaptor protein; TIR domain containing adaptor protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatcatcgacctccctcccagctcctggctctcggcctaagaagcctctaggcaagatggctgactggttcaggcagaccctgctgaagaagcccaagaagaggcccaactccccagaaagcacctccagcgatgcttcacagcctacctcacaggacagcccactacccccaagcctcagctcagtcacgtctcccagcctgccacccacacatgcgagtgacagtggcagtagtcgctggagcaaagactatgacgtctgcgtgtgccacagtgaggaagacctggtggccgcccaggacctggtctcctacttggaaggcagcactgccagcctgcgctgcttcctgcaactccgggatgcaaccccaggcggcgctatagtgtccgagctgtgccaggcactgagcagtagtcactgccgggtgctgctcatcacgccgggcttccttcaggacccctggtgcaagtaccagatgctgcaggccctgaccgaggctccaggggccgagggctgcaccatccccctgctgtcgggcctcagcagagctgcctacccacctgagctccgattcatgtactacgtcgatggcaggggccctgatggtggctttcgtcaagtcaaagaagctgtcatgcgttatctgcagacactcagttggcacttgttatatcatgggaccccggaaattggagtgaagctagaaacagaaaacccatgcagggcctcggattcccacaaatgtgacaagaggtatagggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
- family with sequence similarity 62 (C2 domain containing) member B
- HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3

Buy TIRAP-toll-interleukin 1 receptor (TIR) domain containing adaptor protein Gene now

Add to cart