Login to display prices
Login to display prices
HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene View larger

HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene

PTXBC002373

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene

Proteogenix catalog: PTXBC002373
Ncbi symbol: HSPBP1
Product name: HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene
Size: 2ug
Accessions: BC002373
Gene id: 23640
Gene description: HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms: FES1; hsp70-binding protein 1; HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1; heat shock protein-binding protein 1; hsp70 interacting protein; HSPA (Hsp70) binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagacgaaggctcaagggggagccgcctgcccctggcgctgcccccggcctcccagggttgctcttcagggggcggcggcggcggctcctcggctgggggctcgggcaattcccggcccccacgcaacctccaaggcttgctgcagatggccatcaccgcgggctctgaagagccagaccctcctccagaaccgatgagtgaggagaggcgtcagtggctgcaggaggccatgtcggctgccttccgaggccagcgggaggaggtggagcagatgaagagctgcctccgagtgctgtcacagcccatgccccccactgctggggaggccgagcaggcggccgaccagcaagagcgagagggggccctggagctgctggccgacctgtgtgagaacatggacaatgccgcagacttctgccagctgtctggcatgcacctgctggtgggccggtacctggaggcgggggctgcgggactgcggtggcgggcggcacagctcatcggcacgtgcagtcagaacgtggcagccatccaggagcaggtgctgggcctgggtgccctgcgtaagctgctgcggctgctggaccgcgacgcctgcgacacggtgcgcgtcaaggccctcttcgccatctcctgtctggtccgagagcaggaggctgggctgctgcagttcctccgcctggacggcttctctgtgttgatgagggccatgcagcagcaggtgcagaagctcaaggtcaaatcagcattcctgctgcagaacctgctggtgggccaccctgaacacaaagggaccctgtgctccatggggatggtccagcagctggtggccctggtgcggacagagcacagccccttccacgagcacgtgcttggagccctgtgcagcctggtgacagactttccgcagggtgtgcgcgagtgtcgggagccggaactgggcctggaggagctcctccgccaccgctgtcagctgctgcagcagcatgaggagtaccaggaggagctggagttctgtgaaaagctgctacagacctgtttctccagcccagcggacgacagcatggatcggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: