No products
Prices are tax excluded
PTXBC002373
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002373 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSPBP1 |
| Origin species: | Human |
| Product name: | HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene |
| Size: | 2ug |
| Accessions: | BC002373 |
| Gene id: | 23640 |
| Gene description: | HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 |
| Synonyms: | FES1; hsp70-binding protein 1; HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1; heat shock protein-binding protein 1; hsp70 interacting protein; HSPA (Hsp70) binding protein 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagacgaaggctcaagggggagccgcctgcccctggcgctgcccccggcctcccagggttgctcttcagggggcggcggcggcggctcctcggctgggggctcgggcaattcccggcccccacgcaacctccaaggcttgctgcagatggccatcaccgcgggctctgaagagccagaccctcctccagaaccgatgagtgaggagaggcgtcagtggctgcaggaggccatgtcggctgccttccgaggccagcgggaggaggtggagcagatgaagagctgcctccgagtgctgtcacagcccatgccccccactgctggggaggccgagcaggcggccgaccagcaagagcgagagggggccctggagctgctggccgacctgtgtgagaacatggacaatgccgcagacttctgccagctgtctggcatgcacctgctggtgggccggtacctggaggcgggggctgcgggactgcggtggcgggcggcacagctcatcggcacgtgcagtcagaacgtggcagccatccaggagcaggtgctgggcctgggtgccctgcgtaagctgctgcggctgctggaccgcgacgcctgcgacacggtgcgcgtcaaggccctcttcgccatctcctgtctggtccgagagcaggaggctgggctgctgcagttcctccgcctggacggcttctctgtgttgatgagggccatgcagcagcaggtgcagaagctcaaggtcaaatcagcattcctgctgcagaacctgctggtgggccaccctgaacacaaagggaccctgtgctccatggggatggtccagcagctggtggccctggtgcggacagagcacagccccttccacgagcacgtgcttggagccctgtgcagcctggtgacagactttccgcagggtgtgcgcgagtgtcgggagccggaactgggcctggaggagctcctccgccaccgctgtcagctgctgcagcagcatgaggagtaccaggaggagctggagttctgtgaaaagctgctacagacctgtttctccagcccagcggacgacagcatggatcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 - resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) - nuclear fragile X mental retardation protein interacting protein 1 - small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta |