HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene View larger

HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002373
Product type: DNA & cDNA
Ncbi symbol: HSPBP1
Origin species: Human
Product name: HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene
Size: 2ug
Accessions: BC002373
Gene id: 23640
Gene description: HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms: FES1; hsp70-binding protein 1; HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1; heat shock protein-binding protein 1; hsp70 interacting protein; HSPA (Hsp70) binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagacgaaggctcaagggggagccgcctgcccctggcgctgcccccggcctcccagggttgctcttcagggggcggcggcggcggctcctcggctgggggctcgggcaattcccggcccccacgcaacctccaaggcttgctgcagatggccatcaccgcgggctctgaagagccagaccctcctccagaaccgatgagtgaggagaggcgtcagtggctgcaggaggccatgtcggctgccttccgaggccagcgggaggaggtggagcagatgaagagctgcctccgagtgctgtcacagcccatgccccccactgctggggaggccgagcaggcggccgaccagcaagagcgagagggggccctggagctgctggccgacctgtgtgagaacatggacaatgccgcagacttctgccagctgtctggcatgcacctgctggtgggccggtacctggaggcgggggctgcgggactgcggtggcgggcggcacagctcatcggcacgtgcagtcagaacgtggcagccatccaggagcaggtgctgggcctgggtgccctgcgtaagctgctgcggctgctggaccgcgacgcctgcgacacggtgcgcgtcaaggccctcttcgccatctcctgtctggtccgagagcaggaggctgggctgctgcagttcctccgcctggacggcttctctgtgttgatgagggccatgcagcagcaggtgcagaagctcaaggtcaaatcagcattcctgctgcagaacctgctggtgggccaccctgaacacaaagggaccctgtgctccatggggatggtccagcagctggtggccctggtgcggacagagcacagccccttccacgagcacgtgcttggagccctgtgcagcctggtgacagactttccgcagggtgtgcgcgagtgtcgggagccggaactgggcctggaggagctcctccgccaccgctgtcagctgctgcagcagcatgaggagtaccaggaggagctggagttctgtgaaaagctgctacagacctgtttctccagcccagcggacgacagcatggatcggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
- resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
- nuclear fragile X mental retardation protein interacting protein 1
- small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta

Buy HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene now

Add to cart