Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SGTB-small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta Gene
PTXBC012044
New product
Data sheet of SGTB-small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SGTB-small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012044 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SGTB |
| Origin species: | Human |
| Product name: | SGTB-small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta Gene |
| Size: | 2ug |
| Accessions: | BC012044 |
| Gene id: | 54557 |
| Gene description: | small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta |
| Synonyms: | SGT2; small glutamine-rich tetratricopeptide repeat-containing protein beta; beta-SGT; small glutamine rich protein with tetratricopeptide repeats 2; small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta; small glutamine rich tetratricopeptide repeat containing beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcatctatcaagcacctggtttatgcagttattcgtttcttacgggaacaaagtcagatggacacttacacctcggatgaacaagaaagtttggaagttgcaattcagtgcttggagacagtttttaagatcagcccagaagatacacacctagcagtttcacagcctttgacagaaatgtttaccagttccttctgtaagaatgacgttctgcccctttcaaactcagtgcctgaagatgtgggaaaagctgaccaattaaaagatgaaggcaataaccacatgaaagaagaaaattatgctgctgcagtggattgttacacacaggcaatagaattggatcccaataatgcagtttactattgcaacagggctgctgctcagagcaaattaggtcactacacagatgcgataaaggattgtgaaaaagcaatagcaattgattcaaagtacagcaaggcctatgggagaatggggctggccctcactgccttgaataaatttgaagaagcagttacaagttatcaaaaggcattagatcttgaccctgaaaatgattcctataagtcaaatctgaaaatagcagaacagaagttaagagaggtatccagtcctacaggaactggactgagctttgacatggctagcttgataaataatccagccttcattagtatggcggcaagtttaatgcagaaccctcaagttcaacagctaatgtcaggaatgatgacaaatgccattgggggacctgctgctggagttgggggcctaactgacctgtcaagcctcatccaagcgggacagcagtttgctcagcagatacagcaacaaaatcctgaacttatagagcaactgagaaatcacatccggagcagatcattcagcagcagcgctgaagagcattcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - melanoma antigen family A, 1 (directs expression of antigen MZ2-E) - menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 - eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa |