MAGEA1-melanoma antigen family A, 1 (directs expression of antigen MZ2-E) Gene View larger

MAGEA1-melanoma antigen family A, 1 (directs expression of antigen MZ2-E) Gene

PTXBC017555

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEA1-melanoma antigen family A, 1 (directs expression of antigen MZ2-E) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEA1-melanoma antigen family A, 1 (directs expression of antigen MZ2-E) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017555
Product type: DNA & cDNA
Ncbi symbol: MAGEA1
Origin species: Human
Product name: MAGEA1-melanoma antigen family A, 1 (directs expression of antigen MZ2-E) Gene
Size: 2ug
Accessions: BC017555
Gene id: 4100
Gene description: melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
Synonyms: CT1.1; MAGE1; melanoma-associated antigen 1; MAGE-1 antigen; antigen MZ2-E; cancer/testis antigen 1.1; cancer/testis antigen family 1, member 1; melanoma antigen MAGE-1; melanoma antigen family A 1; melanoma antigen family A, 1 (directs expression of antigen MZ2-E); melanoma antigen family A1; melanoma-associated antigen MZ2-E; MAGE family member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcttgagcagaggagtctgcactgcaagcctgaggaagcccttgaggcccaacaagaggccctgggcctggtgtgtgtgcaggctgccgcctcctcctcctctcctctggtcctgggcaccctggaggaggtgcccactgctgggtcaacagatcctccccagagtcctcagggagcctccgcctttcccactaccatcaacttcactcgacagaggcaacccagtgagggttccagcagccgtgaagaggaggggccaagcacctcttgtatcctggagtccttgttccgagcagtaatcactaagaaggtggctgatttggttggttttctgctcctcaaatatcgagccagggagccagtcacaaaggcagaaatgctggagagtgtcatcaaaaattacaagcactgttttcctgagatcttcggcaaagcctctgagtccttgcagctggtctttggcattgacgtgaaggaagcagaccccaccggccactcctatgtccttgtcacctgcctaggtctctcctatgatggcctgctgggtgataatcagatcatgcccaagacaggcttcctgataattgtcctggtcatgattgcaatggagggcggccatgctcctgaggaggaaatctgggaggagctgagtgtgatggaggtgtatgatgggagggagcacagtgcctatggggagcccaggaagctgctcacccaagatttggtgcaggaaaagtacctggagtaccggcaggtgccggacagtgatcccgcacgctatgagttcctgtggggtccaagggcccttgctgaaaccagctatgtgaaagtccttgagtatgtgatcaaggtcagtgcaagagttcgctttttcttcccatccctgcgtgaagcagctttgagagaggaggaagagggagtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
- eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
- FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)

Buy MAGEA1-melanoma antigen family A, 1 (directs expression of antigen MZ2-E) Gene now

Add to cart