MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene View larger

MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000820
Product type: DNA & cDNA
Ncbi symbol: MNAT1
Origin species: Human
Product name: MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene
Size: 2ug
Accessions: BC000820
Gene id: 4331
Gene description: menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
Synonyms: MNAT1, CDK activating kinase assembly factor; CAP35; MAT1; RNF66; TFB3; CDK-activating kinase assembly factor MAT1; CDK7/cyclin-H assembly factor; MNAT CDK-activating kinase assembly factor 1; RING finger protein 66; RING finger protein MAT1; cyclin G1 interacting protein; menage a trois 1 (CAK assembly factor); menage a trois homolog 1, cyclin H assembly factor; menage a trois-like protein 1 cyclin H assembly factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgatcagggttgccctcggtgtaagaccaccaaatatcggaacccctccttgaagctgatggtgaatgtgtgcggacacactctctgtgaaagttgtgtagatttactgtttgtgagaggagctggaaactgccctgagtgtggtactccactcagaaagagcaacttcagggtacaactctttgaagatcccactgttgacaaggaggttgagatcaggaaaaaagtgctaaagatatacaataaaagggaagaagattttcctagtctaagagaatacaatgatttcttggaagaagtggaagaaattgttttcaacttgaccaacaatgtggatttggacaacaccaaaaagaaaatggagatataccaaaaggaaaacaaagatgttattcagaaaaataaattaaagctgactcgagaacaggaagaactggaagaagctttagaagtggaacgacaggaaaatgaacaaagaagattatttatacaaaaagaagaacaactgcagcagattctaaaaaggaagaataagcaggcttttttagatgagctggagagttctgatctccctgttgctctgcttttggctcagcataaagatagatctacccaattagaaatgcaacttgagaaacccaaacctgtaaaaccagtgacgttttccacaggcatcaaaatgggtcaacatatttcactggcacctattcacaagcttgaagaagctctgtatgaataccagccactgcagatagagacatatggaccacatgttcctgagcttgagatgctaggaagacttgggtatttaaaccatgtcagagctgcctcaccacaggaccttgctggaggctatacttcttctcttgcttgtcacagagcactacaggatgcattcagtgggcttttctggcagcccagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
- eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
- FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
- serpin peptidase inhibitor, clade D (heparin cofactor), member 1

Buy MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene now

Add to cart