Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene
PTXBC000820
New product
Data sheet of MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000820 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MNAT1 |
| Origin species: | Human |
| Product name: | MNAT1-menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC000820 |
| Gene id: | 4331 |
| Gene description: | menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) |
| Synonyms: | MNAT1, CDK activating kinase assembly factor; CAP35; MAT1; RNF66; TFB3; CDK-activating kinase assembly factor MAT1; CDK7/cyclin-H assembly factor; MNAT CDK-activating kinase assembly factor 1; RING finger protein 66; RING finger protein MAT1; cyclin G1 interacting protein; menage a trois 1 (CAK assembly factor); menage a trois homolog 1, cyclin H assembly factor; menage a trois-like protein 1 cyclin H assembly factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgatcagggttgccctcggtgtaagaccaccaaatatcggaacccctccttgaagctgatggtgaatgtgtgcggacacactctctgtgaaagttgtgtagatttactgtttgtgagaggagctggaaactgccctgagtgtggtactccactcagaaagagcaacttcagggtacaactctttgaagatcccactgttgacaaggaggttgagatcaggaaaaaagtgctaaagatatacaataaaagggaagaagattttcctagtctaagagaatacaatgatttcttggaagaagtggaagaaattgttttcaacttgaccaacaatgtggatttggacaacaccaaaaagaaaatggagatataccaaaaggaaaacaaagatgttattcagaaaaataaattaaagctgactcgagaacaggaagaactggaagaagctttagaagtggaacgacaggaaaatgaacaaagaagattatttatacaaaaagaagaacaactgcagcagattctaaaaaggaagaataagcaggcttttttagatgagctggagagttctgatctccctgttgctctgcttttggctcagcataaagatagatctacccaattagaaatgcaacttgagaaacccaaacctgtaaaaccagtgacgttttccacaggcatcaaaatgggtcaacatatttcactggcacctattcacaagcttgaagaagctctgtatgaataccagccactgcagatagagacatatggaccacatgttcctgagcttgagatgctaggaagacttgggtatttaaaccatgtcagagctgcctcaccacaggaccttgctggaggctatacttcttctcttgcttgtcacagagcactacaggatgcattcagtgggcttttctggcagcccagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 - eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa - FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) - serpin peptidase inhibitor, clade D (heparin cofactor), member 1 |