Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPIND1-serpin peptidase inhibitor, clade D (heparin cofactor), member 1 Gene
PTXBC035028
New product
Data sheet of SERPIND1-serpin peptidase inhibitor, clade D (heparin cofactor), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPIND1-serpin peptidase inhibitor, clade D (heparin cofactor), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035028 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPIND1 |
| Origin species: | Human |
| Product name: | SERPIND1-serpin peptidase inhibitor, clade D (heparin cofactor), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC035028 |
| Gene id: | 3053 |
| Gene description: | serpin peptidase inhibitor, clade D (heparin cofactor), member 1 |
| Synonyms: | D22S673; HC2; HCF2; HCII; HLS2; LS2; THPH10; heparin cofactor 2; leuserpin 2; protease inhibitor leuserpin-2; serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1; serpin D1; serpin peptidase inhibitor, clade D (heparin cofactor), member 1; serpin family D member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaacactcattaaacgcacttctcattttcctcatcataacatctgcgtggggtgggagcaaaggcccgctggatcagctagagaaaggaggggaaactgctcagtctgcagatccccagtgggagcagttaaataacaaaaacctgagcatgcctcttctccctgccgacttccacaaggaaaacaccgtcaccaacgactggattccagagggggaggaggacgacgactatctggacctggagaagatattcagtgaagacgacgactacatcgacatcgtcgacagtctgtcagtttccccgacagactctgatgtgagtgctgggaacatcctccagctttttcatggcaagagccggatccagcgtcttaacatcgtcaacgccaagttcgctttcaacctctaccgagtgctgaaagaccaggtcaacactttcgataacatcttcatagcacccgttggcatttctactgcgatgggtatgatttccttaggtctgaagggagagacccatgaacaagtgcactcgattttgcattttaaagactttgttaatgccagcagcaagtatgaaatcacgaccattcataatctcttccgtaagctgactcatcgcctcttcaggaggaattttgggtacacactgcggtcagtcaatgacctttatatccagaagcagtttccaatcctgcttgacttcaaaactaaagtaagagagtattactttgctgaggcccagatagctgacttctcagaccctgccttcatatcaaaaaccaacaaccacatcatgaagctcaccaagggcctcataaaagatgctctggagaatatagaccctgctacccagatgatgattctcaactgcatctacttcaaaggatcctgggtgaataaattcccagtggaaatgacacacaaccacaacttccggctgaatgagagagaggtagttaaggtttccatgatgcagaccaaggggaacttcctcgcagcaaatgaccaggagctggactgcgacatcctccagctggaatacgtggggggcatcagcatgctaattgtggtcccacacaagatgtctgggatgaagaccctcgaagcgcaactgacacccggggtggtggagagatggcaaaaaagcatgacaaacagaactcgagaagtgcttctgccgaaattcaagctggagaagaactacaatctagtggagtccctgaagttgatggggatcaggatgctgtttgacaaaaatggcaacatggcaggcatctcagaccaaaggatcgccatcgacctgttcaagcaccaaggcacgatcacagtgaacgaggaaggcacccaagccaccactgtgaccacggtggggttcatgccgctgtccacccaagtccgcttcactgtcgaccgcccctttcttttcctcatctacgagcaccgcaccagctgcctgctcttcatgggaagagtggccaaccccagcaggtcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, shaker-related subfamily, member 3 - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 - sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B - immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides |